Incidental Mutation 'R7785:2610021A01Rik'
ID 599496
Institutional Source Beutler Lab
Gene Symbol 2610021A01Rik
Ensembl Gene ENSMUSG00000091474
Gene Name RIKEN cDNA 2610021A01 gene
Synonyms
MMRRC Submission 045841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7785 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 41248654-41277957 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41262617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 70 (F70L)
Ref Sequence ENSEMBL: ENSMUSP00000127760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163475] [ENSMUST00000205433]
AlphaFold E9Q0Q3
Predicted Effect probably benign
Transcript: ENSMUST00000163475
AA Change: F70L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127760
Gene: ENSMUSG00000091474
AA Change: F70L

DomainStartEndE-ValueType
KRAB 18 78 1.32e-32 SMART
ZnF_C2H2 415 437 4.54e-4 SMART
ZnF_C2H2 443 465 3.69e-4 SMART
ZnF_C2H2 471 493 5.14e-3 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 3.16e-3 SMART
ZnF_C2H2 555 577 3.16e-3 SMART
ZnF_C2H2 583 605 8.6e-5 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.43e-4 SMART
ZnF_C2H2 667 689 1.72e-4 SMART
ZnF_C2H2 695 717 9.73e-4 SMART
ZnF_C2H2 723 745 2.02e-1 SMART
ZnF_C2H2 751 773 1.69e-3 SMART
ZnF_C2H2 779 801 3.69e-4 SMART
ZnF_C2H2 807 829 7.37e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205433
AA Change: F70L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 109,965,032 (GRCm39) probably null Het
Adamts5 T C 16: 85,659,892 (GRCm39) D800G probably damaging Het
Afm T C 5: 90,698,032 (GRCm39) V478A possibly damaging Het
Akap7 T A 10: 25,096,559 (GRCm39) K233M probably damaging Het
Apbb1 T C 7: 105,216,630 (GRCm39) N61S probably benign Het
Atp8b1 A T 18: 64,689,921 (GRCm39) S604T probably damaging Het
Bcl2l14 G T 6: 134,409,223 (GRCm39) V266F possibly damaging Het
Btnl2 T A 17: 34,580,137 (GRCm39) H223Q probably benign Het
Cap2 A G 13: 46,789,224 (GRCm39) E255G probably benign Het
Chd6 A T 2: 160,812,095 (GRCm39) F1366Y possibly damaging Het
Cryl1 A T 14: 57,512,938 (GRCm39) S310T probably benign Het
Cyp2c69 A G 19: 39,839,610 (GRCm39) C338R probably damaging Het
Dclre1c C T 2: 3,425,273 (GRCm39) Q7* probably null Het
Dhcr7 A G 7: 143,399,209 (GRCm39) E193G probably damaging Het
Dnaaf10 T A 11: 17,179,785 (GRCm39) V262E probably damaging Het
Dnmt1 T C 9: 20,833,345 (GRCm39) K652E probably damaging Het
Emilin3 A T 2: 160,752,694 (GRCm39) C85* probably null Het
Erp44 G A 4: 48,243,531 (GRCm39) P26S probably benign Het
Fxr1 A G 3: 34,100,403 (GRCm39) I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 141,794,171 (GRCm39) probably benign Het
Gpc5 A G 14: 115,654,632 (GRCm39) N484S probably benign Het
Grm8 A G 6: 27,618,636 (GRCm39) V402A probably damaging Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Iqgap1 A G 7: 80,387,917 (GRCm39) L910P probably damaging Het
Klra2 A T 6: 131,222,253 (GRCm39) F13I possibly damaging Het
Lmtk2 T C 5: 144,111,571 (GRCm39) S764P probably benign Het
Ndufs1 T C 1: 63,186,558 (GRCm39) D637G probably damaging Het
Nnmt G A 9: 48,503,309 (GRCm39) S239F probably benign Het
Pdcd11 A G 19: 47,093,125 (GRCm39) I468V probably benign Het
Pkhd1l1 T C 15: 44,406,965 (GRCm39) W2401R probably damaging Het
Plec C A 15: 76,090,029 (GRCm39) V104F unknown Het
Polq A G 16: 36,848,239 (GRCm39) Y282C probably damaging Het
Ppp1r37 A T 7: 19,265,996 (GRCm39) V590E probably damaging Het
Prr27 T C 5: 87,991,131 (GRCm39) S248P probably benign Het
Ros1 T C 10: 52,038,944 (GRCm39) E351G probably damaging Het
Scn11a T C 9: 119,645,622 (GRCm39) I111V probably benign Het
Slc35a1 A G 4: 34,675,148 (GRCm39) L130S probably damaging Het
Slc39a12 T C 2: 14,425,029 (GRCm39) L420P probably damaging Het
Sp140 T A 1: 85,547,819 (GRCm39) I182K probably benign Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Trpv3 C A 11: 73,168,558 (GRCm39) H42N probably benign Het
Zan A G 5: 137,427,405 (GRCm39) S2411P unknown Het
Other mutations in 2610021A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:2610021A01Rik APN 7 41,274,996 (GRCm39) missense possibly damaging 0.61
IGL00566:2610021A01Rik APN 7 41,274,815 (GRCm39) missense possibly damaging 0.53
R0940:2610021A01Rik UTSW 7 41,275,858 (GRCm39) missense probably damaging 1.00
R1101:2610021A01Rik UTSW 7 41,276,783 (GRCm39) missense probably damaging 1.00
R1180:2610021A01Rik UTSW 7 41,275,141 (GRCm39) missense probably benign 0.41
R1560:2610021A01Rik UTSW 7 41,275,466 (GRCm39) missense probably benign 0.09
R1740:2610021A01Rik UTSW 7 41,275,549 (GRCm39) nonsense probably null
R1988:2610021A01Rik UTSW 7 41,276,081 (GRCm39) nonsense probably null
R2041:2610021A01Rik UTSW 7 41,275,403 (GRCm39) missense possibly damaging 0.63
R2964:2610021A01Rik UTSW 7 41,275,829 (GRCm39) nonsense probably null
R2965:2610021A01Rik UTSW 7 41,275,829 (GRCm39) nonsense probably null
R2966:2610021A01Rik UTSW 7 41,275,829 (GRCm39) nonsense probably null
R4002:2610021A01Rik UTSW 7 41,274,964 (GRCm39) missense possibly damaging 0.83
R4569:2610021A01Rik UTSW 7 41,275,262 (GRCm39) missense probably benign 0.04
R4708:2610021A01Rik UTSW 7 41,261,309 (GRCm39) missense probably damaging 1.00
R4880:2610021A01Rik UTSW 7 41,276,529 (GRCm39) missense possibly damaging 0.47
R4933:2610021A01Rik UTSW 7 41,276,226 (GRCm39) missense probably damaging 0.98
R5036:2610021A01Rik UTSW 7 41,275,578 (GRCm39) missense possibly damaging 0.92
R5206:2610021A01Rik UTSW 7 41,276,009 (GRCm39) nonsense probably null
R5235:2610021A01Rik UTSW 7 41,274,256 (GRCm39) missense possibly damaging 0.53
R6449:2610021A01Rik UTSW 7 41,275,298 (GRCm39) nonsense probably null
R6488:2610021A01Rik UTSW 7 41,275,298 (GRCm39) nonsense probably null
R6904:2610021A01Rik UTSW 7 41,275,516 (GRCm39) nonsense probably null
R7058:2610021A01Rik UTSW 7 41,275,554 (GRCm39) missense possibly damaging 0.61
R7157:2610021A01Rik UTSW 7 41,276,400 (GRCm39) missense probably damaging 1.00
R7392:2610021A01Rik UTSW 7 41,275,990 (GRCm39) missense probably damaging 1.00
R7589:2610021A01Rik UTSW 7 41,276,396 (GRCm39) missense probably damaging 1.00
R7648:2610021A01Rik UTSW 7 41,261,886 (GRCm39) missense possibly damaging 0.51
R8153:2610021A01Rik UTSW 7 41,275,157 (GRCm39) missense probably benign 0.00
R8199:2610021A01Rik UTSW 7 41,275,304 (GRCm39) missense probably damaging 0.98
R8943:2610021A01Rik UTSW 7 41,275,667 (GRCm39) missense probably damaging 0.98
R9052:2610021A01Rik UTSW 7 41,275,449 (GRCm39) missense probably benign 0.29
R9071:2610021A01Rik UTSW 7 41,274,783 (GRCm39) missense probably benign
R9169:2610021A01Rik UTSW 7 41,261,109 (GRCm39) start gained probably benign
R9209:2610021A01Rik UTSW 7 41,275,837 (GRCm39) missense possibly damaging 0.79
R9281:2610021A01Rik UTSW 7 41,274,184 (GRCm39) missense possibly damaging 0.73
R9530:2610021A01Rik UTSW 7 41,274,165 (GRCm39) missense possibly damaging 0.53
R9612:2610021A01Rik UTSW 7 41,276,327 (GRCm39) missense possibly damaging 0.73
X0067:2610021A01Rik UTSW 7 41,276,741 (GRCm39) missense probably benign 0.09
Z1176:2610021A01Rik UTSW 7 41,274,766 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GTCAGGAAGTAACAATTAGGAAGTCAC -3'
(R):5'- ACTCAACACTATTTGGATAAAAGGAG -3'

Sequencing Primer
(F):5'- AGGAAGTCACTTGTGAATCTTCC -3'
(R):5'- CATCCCTAGACAAGGGATAG -3'
Posted On 2019-11-26