Incidental Mutation 'R7785:Wdr92'
ID599505
Institutional Source Beutler Lab
Gene Symbol Wdr92
Ensembl Gene ENSMUSG00000078970
Gene NameWD repeat domain 92
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R7785 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location17182107-17233796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17229785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 262 (V262E)
Ref Sequence ENSEMBL: ENSMUSP00000040938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046955]
Predicted Effect probably damaging
Transcript: ENSMUST00000046955
AA Change: V262E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970
AA Change: V262E

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Abca8a T C 11: 110,074,206 probably null Het
Adamts5 T C 16: 85,863,004 D800G probably damaging Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Apbb1 T C 7: 105,567,423 N61S probably benign Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Btnl2 T A 17: 34,361,163 H223Q probably benign Het
Cap2 A G 13: 46,635,748 E255G probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Erp44 G A 4: 48,243,531 P26S probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Lmtk2 T C 5: 144,174,753 S764P probably benign Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Wdr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Wdr92 APN 11 17232790 missense probably benign
IGL01801:Wdr92 APN 11 17219015 missense probably benign 0.00
IGL02573:Wdr92 APN 11 17212136 missense possibly damaging 0.92
IGL02985:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03148:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03147:Wdr92 UTSW 11 17229845 missense probably damaging 1.00
R0244:Wdr92 UTSW 11 17229851 missense probably damaging 1.00
R0276:Wdr92 UTSW 11 17229821 missense probably benign 0.33
R1013:Wdr92 UTSW 11 17228183 missense probably damaging 1.00
R1660:Wdr92 UTSW 11 17227183 missense probably benign 0.00
R2030:Wdr92 UTSW 11 17229832 missense probably benign
R4663:Wdr92 UTSW 11 17232853 missense probably benign 0.01
R4676:Wdr92 UTSW 11 17229794 missense probably benign 0.00
R4822:Wdr92 UTSW 11 17227165 missense probably damaging 1.00
R5328:Wdr92 UTSW 11 17222220 missense probably damaging 0.97
R5439:Wdr92 UTSW 11 17212031 missense possibly damaging 0.46
R5473:Wdr92 UTSW 11 17224591 missense probably damaging 0.99
R5642:Wdr92 UTSW 11 17227263 missense possibly damaging 0.89
R5771:Wdr92 UTSW 11 17224638 missense probably benign 0.00
R6680:Wdr92 UTSW 11 17229857 missense probably damaging 1.00
R6889:Wdr92 UTSW 11 17222309 missense probably damaging 1.00
R7367:Wdr92 UTSW 11 17232712 missense probably damaging 1.00
R7693:Wdr92 UTSW 11 17212064 missense probably benign 0.25
Z1176:Wdr92 UTSW 11 17228184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGAGTCAGGAAGGTGCC -3'
(R):5'- TGAGCATCCTGGCATTGAAGTAATC -3'

Sequencing Primer
(F):5'- TGCTAACCCAGACTGTACTCC -3'
(R):5'- TTCCAGAGGTGAAGACTCC -3'
Posted On2019-11-26