Incidental Mutation 'R7785:Cap2'
ID 599507
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name CAP, adenylate cyclase-associated protein, 2 (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7785 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 46501848-46650281 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46635748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 255 (E255G)
Ref Sequence ENSEMBL: ENSMUSP00000021802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably benign
Transcript: ENSMUST00000021802
AA Change: E255G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: E255G

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
AA Change: E143G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: E143G

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126687
Predicted Effect probably benign
Transcript: ENSMUST00000225824
AA Change: E200G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0790 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Abca8a T C 11: 110,074,206 probably null Het
Adamts5 T C 16: 85,863,004 D800G probably damaging Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Apbb1 T C 7: 105,567,423 N61S probably benign Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Btnl2 T A 17: 34,361,163 H223Q probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Erp44 G A 4: 48,243,531 P26S probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Lmtk2 T C 5: 144,174,753 S764P probably benign Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Wdr92 T A 11: 17,229,785 V262E probably damaging Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46639949 splice site probably benign
IGL01927:Cap2 APN 13 46635633 missense probably benign 0.03
IGL02213:Cap2 APN 13 46635611 splice site probably benign
IGL02511:Cap2 APN 13 46531022 start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46525492 missense probably benign 0.00
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0385:Cap2 UTSW 13 46560547 missense probably damaging 1.00
R0387:Cap2 UTSW 13 46560516 missense probably damaging 0.99
R0712:Cap2 UTSW 13 46615361 splice site probably null
R1489:Cap2 UTSW 13 46609635 missense probably damaging 1.00
R1666:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1668:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1676:Cap2 UTSW 13 46637859 missense probably damaging 1.00
R1756:Cap2 UTSW 13 46531013 missense probably benign 0.11
R1822:Cap2 UTSW 13 46615347 missense probably benign 0.03
R1867:Cap2 UTSW 13 46640079 missense probably damaging 1.00
R1972:Cap2 UTSW 13 46637899 missense probably damaging 0.98
R1990:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46560502 critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46639841 missense probably benign 0.20
R4024:Cap2 UTSW 13 46637841 splice site probably benign
R4554:Cap2 UTSW 13 46635774 missense probably damaging 1.00
R4748:Cap2 UTSW 13 46639826 missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46610110 missense probably damaging 0.99
R4876:Cap2 UTSW 13 46531021 start codon destroyed probably null
R4902:Cap2 UTSW 13 46531025 missense probably damaging 0.99
R5320:Cap2 UTSW 13 46648364 makesense probably null
R5666:Cap2 UTSW 13 46531083 splice site probably null
R5670:Cap2 UTSW 13 46531083 splice site probably null
R6086:Cap2 UTSW 13 46635712 missense probably damaging 1.00
R6728:Cap2 UTSW 13 46639859 missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46646625 missense probably damaging 1.00
R7889:Cap2 UTSW 13 46646575 missense probably damaging 0.99
R8065:Cap2 UTSW 13 46637861 missense probably damaging 1.00
R8205:Cap2 UTSW 13 46615263 missense probably damaging 1.00
R8425:Cap2 UTSW 13 46609732 missense probably damaging 0.98
R8731:Cap2 UTSW 13 46646530 missense probably benign 0.00
R8738:Cap2 UTSW 13 46531072 missense probably benign 0.00
R9320:Cap2 UTSW 13 46615342 missense probably benign 0.04
R9491:Cap2 UTSW 13 46637890 missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46525450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTCTCAGCAAAGCTCC -3'
(R):5'- CTATGTTCCTGGAGCTGGAG -3'

Sequencing Primer
(F):5'- AGCAAAGCTCCCATCTTCTG -3'
(R):5'- CTCCCTGTATCCTAAGGATGGTG -3'
Posted On 2019-11-26