Incidental Mutation 'R7785:Adamts5'
ID 599513
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms 9530092O11Rik, ADAM-TS5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7785 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 85856173-85901828 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85863004 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 800 (D800G)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
AlphaFold Q9R001
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: D800G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: D800G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Abca8a T C 11: 110,074,206 probably null Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Apbb1 T C 7: 105,567,423 N61S probably benign Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Btnl2 T A 17: 34,361,163 H223Q probably benign Het
Cap2 A G 13: 46,635,748 E255G probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Erp44 G A 4: 48,243,531 P26S probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Lmtk2 T C 5: 144,174,753 S764P probably benign Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Wdr92 T A 11: 17,229,785 V262E probably damaging Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
R8804:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R9209:Adamts5 UTSW 16 85870083 missense probably damaging 1.00
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGGTCCCACCTTGTTG -3'
(R):5'- TACAGCAAGGGTTATACTGACG -3'

Sequencing Primer
(F):5'- CCATGGCTGATGACAGAGTTTAC -3'
(R):5'- ATACTGACGTTGTGAGGATCCC -3'
Posted On 2019-11-26