Incidental Mutation 'R7785:Btnl2'
ID599514
Institutional Source Beutler Lab
Gene Symbol Btnl2
Ensembl Gene ENSMUSG00000024340
Gene Namebutyrophilin-like 2
SynonymsBTLN2, NG9, BTL-II, butyrophylin-like MHC class II associated
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7785 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34354822-34369493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34361163 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 223 (H223Q)
Ref Sequence ENSEMBL: ENSMUSP00000025198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025198] [ENSMUST00000178562]
Predicted Effect probably benign
Transcript: ENSMUST00000025198
AA Change: H223Q

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025198
Gene: ENSMUSG00000024340
AA Change: H223Q

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Blast:IG_like 150 236 4e-12 BLAST
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 361 446 2.6e-6 PFAM
transmembrane domain 457 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178562
AA Change: H223Q

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137048
Gene: ENSMUSG00000024340
AA Change: H223Q

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Pfam:Ig_3 144 222 5.1e-4 PFAM
Pfam:C2-set_2 146 229 1.8e-6 PFAM
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 360 446 3.7e-8 PFAM
Pfam:Ig_2 364 452 4.5e-2 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Abca8a T C 11: 110,074,206 probably null Het
Adamts5 T C 16: 85,863,004 D800G probably damaging Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Apbb1 T C 7: 105,567,423 N61S probably benign Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Cap2 A G 13: 46,635,748 E255G probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Erp44 G A 4: 48,243,531 P26S probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Lmtk2 T C 5: 144,174,753 S764P probably benign Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Wdr92 T A 11: 17,229,785 V262E probably damaging Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Btnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Btnl2 APN 17 34363239 nonsense probably null
IGL02252:Btnl2 APN 17 34365390 missense possibly damaging 0.82
IGL02651:Btnl2 APN 17 34356222 start codon destroyed probably null 1.00
IGL02892:Btnl2 APN 17 34362668 missense possibly damaging 0.61
IGL02939:Btnl2 APN 17 34361069 missense probably benign 0.02
IGL03098:Btnl2 UTSW 17 34365216 missense probably benign 0.20
R0504:Btnl2 UTSW 17 34358117 missense probably benign 0.17
R0706:Btnl2 UTSW 17 34368662 missense probably benign 0.21
R1460:Btnl2 UTSW 17 34366450 missense probably benign
R1590:Btnl2 UTSW 17 34361140 missense possibly damaging 0.86
R1597:Btnl2 UTSW 17 34363237 missense probably damaging 1.00
R1880:Btnl2 UTSW 17 34365363 missense possibly damaging 0.89
R3009:Btnl2 UTSW 17 34363518 missense probably damaging 0.99
R3160:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3162:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3722:Btnl2 UTSW 17 34358135 missense possibly damaging 0.74
R4760:Btnl2 UTSW 17 34363195 missense probably damaging 0.99
R4786:Btnl2 UTSW 17 34363348 missense probably damaging 1.00
R4839:Btnl2 UTSW 17 34365286 nonsense probably null
R5456:Btnl2 UTSW 17 34363321 missense probably benign 0.05
R6959:Btnl2 UTSW 17 34363359 missense possibly damaging 0.47
R7011:Btnl2 UTSW 17 34363513 missense probably damaging 1.00
R7650:Btnl2 UTSW 17 34358129 missense probably damaging 1.00
R7822:Btnl2 UTSW 17 34363314 missense possibly damaging 0.91
R7988:Btnl2 UTSW 17 34358275 missense possibly damaging 0.87
R8051:Btnl2 UTSW 17 34363499 missense probably damaging 1.00
R8165:Btnl2 UTSW 17 34368708 missense possibly damaging 0.62
R8272:Btnl2 UTSW 17 34356301 critical splice donor site probably null
Z1177:Btnl2 UTSW 17 34363519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GAGGTCCAGCTTGTATGCAC -3'
(R):5'- CTGTGTAGCAAAATTAACACAGTGG -3'

Sequencing Primer
(F):5'- TTGTATGCACGTCCCGAG -3'
(R):5'- AAAGAAGAGTTGCTGCTG -3'
Posted On2019-11-26