Incidental Mutation 'R7786:Olfr656'
ID599535
Institutional Source Beutler Lab
Gene Symbol Olfr656
Ensembl Gene ENSMUSG00000073924
Gene Nameolfactory receptor 656
SynonymsGA_x6K02T2PBJ9-7245486-7246451, MOR27-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7786 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104613955-104621603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104617718 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 13 (I13N)
Ref Sequence ENSEMBL: ENSMUSP00000149625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098172] [ENSMUST00000215575]
Predicted Effect probably benign
Transcript: ENSMUST00000098172
AA Change: I21N

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095774
Gene: ENSMUSG00000073924
AA Change: I21N

DomainStartEndE-ValueType
Pfam:7tm_4 41 319 5.2e-105 PFAM
Pfam:7TM_GPCR_Srsx 42 316 1.1e-8 PFAM
Pfam:7tm_1 51 302 4.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215575
AA Change: I13N

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 T C 18: 74,792,447 S94P probably damaging Het
Adam18 C T 8: 24,611,118 R676H probably benign Het
Akna A G 4: 63,394,962 L308P probably benign Het
Ambra1 G C 2: 91,767,796 V101L possibly damaging Het
Arnt A G 3: 95,484,956 D377G probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc173 A T 2: 69,781,748 W179R probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cit C A 5: 115,863,018 Q159K probably benign Het
D430042O09Rik A G 7: 125,865,294 I1278V probably benign Het
Dnah1 A T 14: 31,262,521 H3935Q probably damaging Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Fam71d T A 12: 78,719,629 S391T probably benign Het
Fcrla G T 1: 170,920,857 P265Q possibly damaging Het
Gabbr1 A T 17: 37,070,063 N766I probably damaging Het
Galnt14 T A 17: 73,709,981 T27S probably benign Het
Gatad2b T C 3: 90,355,679 I476T probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Gtf2ird1 C A 5: 134,390,899 G71* probably null Het
Hdac11 T A 6: 91,173,176 L319* probably null Het
Hsd11b2 T A 8: 105,518,874 W4R probably damaging Het
Krt76 T A 15: 101,890,530 E240V probably damaging Het
Man2b1 C T 8: 85,085,456 Q180* probably null Het
Megf8 T C 7: 25,317,695 probably null Het
Mlh3 T C 12: 85,266,737 T892A probably benign Het
Mmp21 C T 7: 133,675,035 S413N probably benign Het
Nav1 T C 1: 135,469,995 D812G probably damaging Het
Nox4 T A 7: 87,295,842 I71N probably damaging Het
Olfr1140 A T 2: 87,746,301 Y35F probably damaging Het
Olfr641 G A 7: 104,040,723 R309H unknown Het
Oplah T A 15: 76,309,716 I14F possibly damaging Het
Pik3ap1 A G 19: 41,321,585 M432T probably damaging Het
Plin3 G A 17: 56,279,757 T430I probably benign Het
Poc5 C A 13: 96,404,519 Q399K possibly damaging Het
Ptprz1 G A 6: 23,036,993 G2013R probably damaging Het
Rgs7bp T C 13: 105,054,060 D52G probably benign Het
Tenm2 A C 11: 36,010,449 F2488V probably damaging Het
Tnfaip8 G C 18: 50,047,111 A110P unknown Het
Tnfaip8 C T 18: 50,047,112 A110V unknown Het
Top3a C T 11: 60,776,966 A46T probably damaging Het
Try10 T A 6: 41,355,529 S40T possibly damaging Het
Vav2 C A 2: 27,386,601 L70F probably damaging Het
Xylt1 C A 7: 117,643,475 probably null Het
Other mutations in Olfr656
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Olfr656 APN 7 104617721 missense probably damaging 0.98
IGL01908:Olfr656 APN 7 104617699 missense probably damaging 1.00
IGL02695:Olfr656 APN 7 104618471 missense probably damaging 1.00
IGL03055:Olfr656 UTSW 7 104618206 missense probably damaging 1.00
R0128:Olfr656 UTSW 7 104618581 missense probably damaging 1.00
R0184:Olfr656 UTSW 7 104618240 missense probably damaging 1.00
R4674:Olfr656 UTSW 7 104618424 nonsense probably null
R4675:Olfr656 UTSW 7 104618424 nonsense probably null
R4723:Olfr656 UTSW 7 104618489 missense possibly damaging 0.56
R4979:Olfr656 UTSW 7 104618605 missense probably null 0.03
R6273:Olfr656 UTSW 7 104617895 missense probably damaging 1.00
R6359:Olfr656 UTSW 7 104618303 missense probably damaging 1.00
R6582:Olfr656 UTSW 7 104618441 missense probably damaging 1.00
R6750:Olfr656 UTSW 7 104618113 missense probably damaging 0.99
R7426:Olfr656 UTSW 7 104617852 missense probably damaging 1.00
R8068:Olfr656 UTSW 7 104618253 nonsense probably null
R8324:Olfr656 UTSW 7 104618114 missense probably benign 0.00
R8486:Olfr656 UTSW 7 104617862 missense possibly damaging 0.47
X0065:Olfr656 UTSW 7 104617758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAACGTTCTGTAGCTAGTG -3'
(R):5'- AGAGATATGCCCAGCTCCAC -3'

Sequencing Primer
(F):5'- AGCTAGTGAAAGTTATTGTGAGCCC -3'
(R):5'- CCAAATCAATGGTTGAGAGCATGC -3'
Posted On2019-11-26