Incidental Mutation 'R7786:Hsd11b2'
ID599540
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Namehydroxysteroid 11-beta dehydrogenase 2
Synonyms11HSD2, 11(beta)-HSD2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7786 (G1)
Quality Score180.009
Status Not validated
Chromosome8
Chromosomal Location105518755-105523988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105518874 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 4 (W4R)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034363]
Predicted Effect probably damaging
Transcript: ENSMUST00000034363
AA Change: W4R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: W4R

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 T C 18: 74,792,447 S94P probably damaging Het
Adam18 C T 8: 24,611,118 R676H probably benign Het
Akna A G 4: 63,394,962 L308P probably benign Het
Ambra1 G C 2: 91,767,796 V101L possibly damaging Het
Arnt A G 3: 95,484,956 D377G probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc173 A T 2: 69,781,748 W179R probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cit C A 5: 115,863,018 Q159K probably benign Het
D430042O09Rik A G 7: 125,865,294 I1278V probably benign Het
Dnah1 A T 14: 31,262,521 H3935Q probably damaging Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Fam71d T A 12: 78,719,629 S391T probably benign Het
Fcrla G T 1: 170,920,857 P265Q possibly damaging Het
Gabbr1 A T 17: 37,070,063 N766I probably damaging Het
Galnt14 T A 17: 73,709,981 T27S probably benign Het
Gatad2b T C 3: 90,355,679 I476T probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Gtf2ird1 C A 5: 134,390,899 G71* probably null Het
Hdac11 T A 6: 91,173,176 L319* probably null Het
Krt76 T A 15: 101,890,530 E240V probably damaging Het
Man2b1 C T 8: 85,085,456 Q180* probably null Het
Megf8 T C 7: 25,317,695 probably null Het
Mlh3 T C 12: 85,266,737 T892A probably benign Het
Mmp21 C T 7: 133,675,035 S413N probably benign Het
Nav1 T C 1: 135,469,995 D812G probably damaging Het
Nox4 T A 7: 87,295,842 I71N probably damaging Het
Olfr1140 A T 2: 87,746,301 Y35F probably damaging Het
Olfr641 G A 7: 104,040,723 R309H unknown Het
Olfr656 T A 7: 104,617,718 I13N probably benign Het
Oplah T A 15: 76,309,716 I14F possibly damaging Het
Pik3ap1 A G 19: 41,321,585 M432T probably damaging Het
Plin3 G A 17: 56,279,757 T430I probably benign Het
Poc5 C A 13: 96,404,519 Q399K possibly damaging Het
Ptprz1 G A 6: 23,036,993 G2013R probably damaging Het
Rgs7bp T C 13: 105,054,060 D52G probably benign Het
Tenm2 A C 11: 36,010,449 F2488V probably damaging Het
Tnfaip8 G C 18: 50,047,111 A110P unknown Het
Tnfaip8 C T 18: 50,047,112 A110V unknown Het
Top3a C T 11: 60,776,966 A46T probably damaging Het
Try10 T A 6: 41,355,529 S40T possibly damaging Het
Vav2 C A 2: 27,386,601 L70F probably damaging Het
Xylt1 C A 7: 117,643,475 probably null Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 105523127 missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 105522897 missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 105523222 missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 105522328 missense probably benign 0.00
gilberto UTSW 8 105523067 missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 105523067 missense possibly damaging 0.96
R1082:Hsd11b2 UTSW 8 105523151 missense probably damaging 0.99
R2050:Hsd11b2 UTSW 8 105523360 missense probably benign 0.27
R4135:Hsd11b2 UTSW 8 105523166 missense probably benign
R5294:Hsd11b2 UTSW 8 105523297 missense probably benign 0.01
R5598:Hsd11b2 UTSW 8 105522511 missense probably benign
R5780:Hsd11b2 UTSW 8 105522155 missense probably damaging 1.00
R6058:Hsd11b2 UTSW 8 105523334 missense possibly damaging 0.59
R6867:Hsd11b2 UTSW 8 105522317 missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 105519123 missense probably damaging 0.99
R8006:Hsd11b2 UTSW 8 105519103 missense possibly damaging 0.95
R8110:Hsd11b2 UTSW 8 105522634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTCTTCGAAAACGGATC -3'
(R):5'- GACTCTTACGTCTGAGCTGC -3'

Sequencing Primer
(F):5'- GGCTTCTTCGAAAACGGATCTAGAC -3'
(R):5'- TCTGCACACTCACCGGTGATG -3'
Posted On2019-11-26