Incidental Mutation 'R7786:Poc5'
ID599546
Institutional Source Beutler Lab
Gene Symbol Poc5
Ensembl Gene ENSMUSG00000021671
Gene NamePOC5 centriolar protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7786 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location96388294-96417737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 96404519 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 399 (Q399K)
Ref Sequence ENSEMBL: ENSMUSP00000096898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099295
AA Change: Q399K

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096898
Gene: ENSMUSG00000021671
AA Change: Q399K

DomainStartEndE-ValueType
coiled coil region 175 206 N/A INTRINSIC
coiled coil region 300 341 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 T C 18: 74,792,447 S94P probably damaging Het
Adam18 C T 8: 24,611,118 R676H probably benign Het
Akna A G 4: 63,394,962 L308P probably benign Het
Ambra1 G C 2: 91,767,796 V101L possibly damaging Het
Arnt A G 3: 95,484,956 D377G probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc173 A T 2: 69,781,748 W179R probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cit C A 5: 115,863,018 Q159K probably benign Het
D430042O09Rik A G 7: 125,865,294 I1278V probably benign Het
Dnah1 A T 14: 31,262,521 H3935Q probably damaging Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Fam71d T A 12: 78,719,629 S391T probably benign Het
Fcrla G T 1: 170,920,857 P265Q possibly damaging Het
Gabbr1 A T 17: 37,070,063 N766I probably damaging Het
Galnt14 T A 17: 73,709,981 T27S probably benign Het
Gatad2b T C 3: 90,355,679 I476T probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Gtf2ird1 C A 5: 134,390,899 G71* probably null Het
Hdac11 T A 6: 91,173,176 L319* probably null Het
Hsd11b2 T A 8: 105,518,874 W4R probably damaging Het
Krt76 T A 15: 101,890,530 E240V probably damaging Het
Man2b1 C T 8: 85,085,456 Q180* probably null Het
Megf8 T C 7: 25,317,695 probably null Het
Mlh3 T C 12: 85,266,737 T892A probably benign Het
Mmp21 C T 7: 133,675,035 S413N probably benign Het
Nav1 T C 1: 135,469,995 D812G probably damaging Het
Nox4 T A 7: 87,295,842 I71N probably damaging Het
Olfr1140 A T 2: 87,746,301 Y35F probably damaging Het
Olfr641 G A 7: 104,040,723 R309H unknown Het
Olfr656 T A 7: 104,617,718 I13N probably benign Het
Oplah T A 15: 76,309,716 I14F possibly damaging Het
Pik3ap1 A G 19: 41,321,585 M432T probably damaging Het
Plin3 G A 17: 56,279,757 T430I probably benign Het
Ptprz1 G A 6: 23,036,993 G2013R probably damaging Het
Rgs7bp T C 13: 105,054,060 D52G probably benign Het
Tenm2 A C 11: 36,010,449 F2488V probably damaging Het
Tnfaip8 G C 18: 50,047,111 A110P unknown Het
Tnfaip8 C T 18: 50,047,112 A110V unknown Het
Top3a C T 11: 60,776,966 A46T probably damaging Het
Try10 T A 6: 41,355,529 S40T possibly damaging Het
Vav2 C A 2: 27,386,601 L70F probably damaging Het
Xylt1 C A 7: 117,643,475 probably null Het
Other mutations in Poc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Poc5 APN 13 96410746 missense probably damaging 1.00
IGL01377:Poc5 APN 13 96401631 missense probably benign 0.35
IGL02981:Poc5 APN 13 96401757 critical splice donor site probably null
IGL03031:Poc5 APN 13 96401615 missense probably benign 0.00
R0348:Poc5 UTSW 13 96398866 missense probably null 1.00
R1533:Poc5 UTSW 13 96391644 missense probably damaging 0.96
R1881:Poc5 UTSW 13 96398731 missense probably benign 0.21
R2171:Poc5 UTSW 13 96410749 missense probably damaging 1.00
R2337:Poc5 UTSW 13 96410603 missense probably damaging 0.98
R3419:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R3736:Poc5 UTSW 13 96396816 missense probably damaging 1.00
R4554:Poc5 UTSW 13 96403021 missense probably benign 0.40
R5223:Poc5 UTSW 13 96402955 missense probably benign 0.20
R5436:Poc5 UTSW 13 96396813 missense probably damaging 1.00
R6089:Poc5 UTSW 13 96396671 missense probably damaging 1.00
R6700:Poc5 UTSW 13 96394495 missense probably benign 0.00
R7345:Poc5 UTSW 13 96396796 missense probably damaging 1.00
R7354:Poc5 UTSW 13 96394525 missense probably benign 0.02
R7363:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R7454:Poc5 UTSW 13 96400832 missense possibly damaging 0.93
R7773:Poc5 UTSW 13 96410635 missense probably damaging 1.00
R7953:Poc5 UTSW 13 96402900 missense probably benign 0.27
X0019:Poc5 UTSW 13 96394548 frame shift probably null
X0024:Poc5 UTSW 13 96394548 frame shift probably null
X0034:Poc5 UTSW 13 96394548 frame shift probably null
X0035:Poc5 UTSW 13 96394548 frame shift probably null
X0036:Poc5 UTSW 13 96394548 frame shift probably null
X0037:Poc5 UTSW 13 96394548 frame shift probably null
X0038:Poc5 UTSW 13 96394548 frame shift probably null
X0039:Poc5 UTSW 13 96394548 frame shift probably null
X0040:Poc5 UTSW 13 96394548 frame shift probably null
X0052:Poc5 UTSW 13 96394548 frame shift probably null
X0053:Poc5 UTSW 13 96394548 frame shift probably null
X0054:Poc5 UTSW 13 96394548 frame shift probably null
X0058:Poc5 UTSW 13 96394548 frame shift probably null
X0060:Poc5 UTSW 13 96394548 frame shift probably null
X0061:Poc5 UTSW 13 96394548 frame shift probably null
X0062:Poc5 UTSW 13 96394548 frame shift probably null
X0063:Poc5 UTSW 13 96394548 frame shift probably null
Z1176:Poc5 UTSW 13 96401722 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCTCCAAGATGACCAGTATCTGC -3'
(R):5'- TACTGACCGATTCCTCTGGG -3'

Sequencing Primer
(F):5'- CCAAGATGACCAGTATCTGCATTTTC -3'
(R):5'- ATTCCTCTGGGGCAGGAG -3'
Posted On2019-11-26