Incidental Mutation 'R7786:Krt76'
ID 599551
Institutional Source Beutler Lab
Gene Symbol Krt76
Ensembl Gene ENSMUSG00000075402
Gene Name keratin 76
Synonyms 2310001L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7786 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101884351-101892920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101890530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 240 (E240V)
Ref Sequence ENSEMBL: ENSMUSP00000097754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100179]
AlphaFold Q3UV17
Predicted Effect probably damaging
Transcript: ENSMUST00000100179
AA Change: E240V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: E240V

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 161 5.7e-39 PFAM
Filament 164 479 2.12e-166 SMART
low complexity region 488 551 N/A INTRINSIC
low complexity region 565 593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 T C 18: 74,792,447 S94P probably damaging Het
Adam18 C T 8: 24,611,118 R676H probably benign Het
Akna A G 4: 63,394,962 L308P probably benign Het
Ambra1 G C 2: 91,767,796 V101L possibly damaging Het
Arnt A G 3: 95,484,956 D377G probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc173 A T 2: 69,781,748 W179R probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cit C A 5: 115,863,018 Q159K probably benign Het
D430042O09Rik A G 7: 125,865,294 I1278V probably benign Het
Dnah1 A T 14: 31,262,521 H3935Q probably damaging Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Fam71d T A 12: 78,719,629 S391T probably benign Het
Fcrla G T 1: 170,920,857 P265Q possibly damaging Het
Gabbr1 A T 17: 37,070,063 N766I probably damaging Het
Galnt14 T A 17: 73,709,981 T27S probably benign Het
Gatad2b T C 3: 90,355,679 I476T probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Gtf2ird1 C A 5: 134,390,899 G71* probably null Het
Hdac11 T A 6: 91,173,176 L319* probably null Het
Hsd11b2 T A 8: 105,518,874 W4R probably damaging Het
Man2b1 C T 8: 85,085,456 Q180* probably null Het
Megf8 T C 7: 25,317,695 probably null Het
Mlh3 T C 12: 85,266,737 T892A probably benign Het
Mmp21 C T 7: 133,675,035 S413N probably benign Het
Nav1 T C 1: 135,469,995 D812G probably damaging Het
Nox4 T A 7: 87,295,842 I71N probably damaging Het
Olfr1140 A T 2: 87,746,301 Y35F probably damaging Het
Olfr641 G A 7: 104,040,723 R309H unknown Het
Olfr656 T A 7: 104,617,718 I13N probably benign Het
Oplah T A 15: 76,309,716 I14F possibly damaging Het
Pik3ap1 A G 19: 41,321,585 M432T probably damaging Het
Plin3 G A 17: 56,279,757 T430I probably benign Het
Poc5 C A 13: 96,404,519 Q399K possibly damaging Het
Ptprz1 G A 6: 23,036,993 G2013R probably damaging Het
Rgs7bp T C 13: 105,054,060 D52G probably benign Het
Tenm2 A C 11: 36,010,449 F2488V probably damaging Het
Tnfaip8 G C 18: 50,047,111 A110P unknown Het
Tnfaip8 C T 18: 50,047,112 A110V unknown Het
Top3a C T 11: 60,776,966 A46T probably damaging Het
Try10 T A 6: 41,355,529 S40T possibly damaging Het
Vav2 C A 2: 27,386,601 L70F probably damaging Het
Xylt1 C A 7: 117,643,475 probably null Het
Other mutations in Krt76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Krt76 APN 15 101884888 missense unknown
IGL01475:Krt76 APN 15 101888513 missense probably benign 0.11
IGL01504:Krt76 APN 15 101888173 missense probably damaging 1.00
IGL01506:Krt76 APN 15 101892400 missense probably damaging 0.97
IGL01943:Krt76 APN 15 101889045 missense probably null 0.98
IGL03164:Krt76 APN 15 101887451 missense possibly damaging 0.50
PIT4378001:Krt76 UTSW 15 101892407 missense probably damaging 0.99
R0105:Krt76 UTSW 15 101884912 missense unknown
R0105:Krt76 UTSW 15 101884912 missense unknown
R0448:Krt76 UTSW 15 101890647 missense probably damaging 1.00
R0730:Krt76 UTSW 15 101887349 missense probably damaging 1.00
R0920:Krt76 UTSW 15 101892439 missense possibly damaging 0.80
R1568:Krt76 UTSW 15 101885008 missense unknown
R1779:Krt76 UTSW 15 101892687 missense unknown
R1869:Krt76 UTSW 15 101889487 critical splice donor site probably null
R1911:Krt76 UTSW 15 101888165 nonsense probably null
R2160:Krt76 UTSW 15 101888385 missense probably damaging 1.00
R2504:Krt76 UTSW 15 101884858 missense unknown
R4487:Krt76 UTSW 15 101890482 missense possibly damaging 0.71
R4729:Krt76 UTSW 15 101889081 missense probably damaging 1.00
R4747:Krt76 UTSW 15 101885745 missense probably damaging 1.00
R4912:Krt76 UTSW 15 101888162 nonsense probably null
R5357:Krt76 UTSW 15 101887385 missense probably benign 0.04
R6738:Krt76 UTSW 15 101887478 missense probably benign 0.40
R7808:Krt76 UTSW 15 101890494 missense probably damaging 1.00
R7825:Krt76 UTSW 15 101887503 missense possibly damaging 0.46
R8079:Krt76 UTSW 15 101888390 missense possibly damaging 0.61
R8846:Krt76 UTSW 15 101887337 missense probably damaging 1.00
R8980:Krt76 UTSW 15 101892555 missense unknown
Z1088:Krt76 UTSW 15 101890551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTGGCCCCATAAGCATGAGTC -3'
(R):5'- AAGCCAGGTGGAAAGCCTTAC -3'

Sequencing Primer
(F):5'- TAAGCATGAGTCCCCACTTG -3'
(R):5'- AGGTGGAAAGCCTTACCTTCC -3'
Posted On 2019-11-26