Incidental Mutation 'R7786:Tnfaip8'
ID599556
Institutional Source Beutler Lab
Gene Symbol Tnfaip8
Ensembl Gene ENSMUSG00000062210
Gene Nametumor necrosis factor, alpha-induced protein 8
SynonymsE130304C20Rik, Ssc-2, Nded, Gg2-1, Gm10539
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R7786 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location49979427-50107173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50047112 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 110 (A110V)
Ref Sequence ENSEMBL: ENSMUSP00000136682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126666] [ENSMUST00000128377] [ENSMUST00000134348] [ENSMUST00000145726] [ENSMUST00000148989] [ENSMUST00000153873] [ENSMUST00000179937] [ENSMUST00000180305]
Predicted Effect probably benign
Transcript: ENSMUST00000126666
SMART Domains Protein: ENSMUSP00000121372
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 212 6.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128377
SMART Domains Protein: ENSMUSP00000136152
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 7 166 1.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134348
SMART Domains Protein: ENSMUSP00000119533
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 77 3.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145726
SMART Domains Protein: ENSMUSP00000136665
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 1 100 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148989
SMART Domains Protein: ENSMUSP00000120712
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 3 188 4.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153873
SMART Domains Protein: ENSMUSP00000115396
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 27 114 9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179937
SMART Domains Protein: ENSMUSP00000136030
Gene: ENSMUSG00000062210

DomainStartEndE-ValueType
Pfam:DUF758 3 134 1.1e-54 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000180305
AA Change: A110V
SMART Domains Protein: ENSMUSP00000136682
Gene: ENSMUSG00000062210
AA Change: A110V

DomainStartEndE-ValueType
low complexity region 23 59 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 T C 18: 74,792,447 S94P probably damaging Het
Adam18 C T 8: 24,611,118 R676H probably benign Het
Akna A G 4: 63,394,962 L308P probably benign Het
Ambra1 G C 2: 91,767,796 V101L possibly damaging Het
Arnt A G 3: 95,484,956 D377G probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc173 A T 2: 69,781,748 W179R probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cit C A 5: 115,863,018 Q159K probably benign Het
D430042O09Rik A G 7: 125,865,294 I1278V probably benign Het
Dnah1 A T 14: 31,262,521 H3935Q probably damaging Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Fam71d T A 12: 78,719,629 S391T probably benign Het
Fcrla G T 1: 170,920,857 P265Q possibly damaging Het
Gabbr1 A T 17: 37,070,063 N766I probably damaging Het
Galnt14 T A 17: 73,709,981 T27S probably benign Het
Gatad2b T C 3: 90,355,679 I476T probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Gtf2ird1 C A 5: 134,390,899 G71* probably null Het
Hdac11 T A 6: 91,173,176 L319* probably null Het
Hsd11b2 T A 8: 105,518,874 W4R probably damaging Het
Krt76 T A 15: 101,890,530 E240V probably damaging Het
Man2b1 C T 8: 85,085,456 Q180* probably null Het
Megf8 T C 7: 25,317,695 probably null Het
Mlh3 T C 12: 85,266,737 T892A probably benign Het
Mmp21 C T 7: 133,675,035 S413N probably benign Het
Nav1 T C 1: 135,469,995 D812G probably damaging Het
Nox4 T A 7: 87,295,842 I71N probably damaging Het
Olfr1140 A T 2: 87,746,301 Y35F probably damaging Het
Olfr641 G A 7: 104,040,723 R309H unknown Het
Olfr656 T A 7: 104,617,718 I13N probably benign Het
Oplah T A 15: 76,309,716 I14F possibly damaging Het
Pik3ap1 A G 19: 41,321,585 M432T probably damaging Het
Plin3 G A 17: 56,279,757 T430I probably benign Het
Poc5 C A 13: 96,404,519 Q399K possibly damaging Het
Ptprz1 G A 6: 23,036,993 G2013R probably damaging Het
Rgs7bp T C 13: 105,054,060 D52G probably benign Het
Tenm2 A C 11: 36,010,449 F2488V probably damaging Het
Top3a C T 11: 60,776,966 A46T probably damaging Het
Try10 T A 6: 41,355,529 S40T possibly damaging Het
Vav2 C A 2: 27,386,601 L70F probably damaging Het
Xylt1 C A 7: 117,643,475 probably null Het
Other mutations in Tnfaip8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Tnfaip8 APN 18 50090326 missense probably damaging 1.00
IGL03391:Tnfaip8 APN 18 50090485 missense probably damaging 0.96
FR4304:Tnfaip8 UTSW 18 50046839 frame shift probably null
FR4449:Tnfaip8 UTSW 18 50046839 frame shift probably null
R0605:Tnfaip8 UTSW 18 50046845 small deletion probably benign
R1696:Tnfaip8 UTSW 18 50090223 nonsense probably null
R1804:Tnfaip8 UTSW 18 50090661 missense probably damaging 1.00
R2247:Tnfaip8 UTSW 18 50046845 frame shift probably null
R3963:Tnfaip8 UTSW 18 50090586 missense possibly damaging 0.95
R4258:Tnfaip8 UTSW 18 50090376 missense possibly damaging 0.55
R4738:Tnfaip8 UTSW 18 50090502 missense probably damaging 1.00
R6229:Tnfaip8 UTSW 18 50051675 unclassified probably benign
R7786:Tnfaip8 UTSW 18 50047111 missense unknown
RF024:Tnfaip8 UTSW 18 50046831 critical splice donor site probably benign
RF052:Tnfaip8 UTSW 18 50046833 frame shift probably null
RF062:Tnfaip8 UTSW 18 50046831 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TGGACTCCTTACTCAGCCTG -3'
(R):5'- GAAGACAGCACCATTTCTTCC -3'

Sequencing Primer
(F):5'- GACTCCTTACTCAGCCTGTCTTGG -3'
(R):5'- GACAGCACCATTTCTTCCTAATTAG -3'
Posted On2019-11-26