Incidental Mutation 'R7787:Sgk3'
ID599560
Institutional Source Beutler Lab
Gene Symbol Sgk3
Ensembl Gene ENSMUSG00000025915
Gene Nameserum/glucocorticoid regulated kinase 3
Synonyms2510015P22Rik, cytokine-independent survival kinase, fy, Cisk, A330005P07Rik
Accession Numbers

Genbank: NM_133220; MGI: 2182368

Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location9798107-9900845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9881791 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 214 (L214P)
Ref Sequence ENSEMBL: ENSMUSP00000095437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097826] [ENSMUST00000166384] [ENSMUST00000168907] [ENSMUST00000171265] [ENSMUST00000188298] [ENSMUST00000188738] [ENSMUST00000188782]
PDB Structure
crystal structure of CISK-PX domain [X-RAY DIFFRACTION]
crystal structure of CISK-PX domain with sulfates [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000097826
AA Change: L214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095437
Gene: ENSMUSG00000025915
AA Change: L214P

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166384
AA Change: L214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130078
Gene: ENSMUSG00000025915
AA Change: L214P

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168907
AA Change: L214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126861
Gene: ENSMUSG00000025915
AA Change: L214P

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171265
AA Change: L214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127462
Gene: ENSMUSG00000025915
AA Change: L214P

DomainStartEndE-ValueType
PX 13 120 3.9e-19 SMART
S_TKc 162 419 1.07e-105 SMART
S_TK_X 420 489 1.96e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188298
SMART Domains Protein: ENSMUSP00000139942
Gene: ENSMUSG00000025915

DomainStartEndE-ValueType
Pfam:PX 11 66 4.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188738
AA Change: L214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140496
Gene: ENSMUSG00000025915
AA Change: L214P

DomainStartEndE-ValueType
PX 13 120 2.4e-21 SMART
S_TKc 162 333 2.1e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188782
AA Change: L214P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140318
Gene: ENSMUSG00000025915
AA Change: L214P

DomainStartEndE-ValueType
PX 13 120 2.4e-21 SMART
S_TKc 162 343 4.3e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mutations in this gene result in wavy vibrissae and coat/ hair abnormalities, including sparse and waved hair, due to impaired hair follicle development and/or hair cycle defects. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(2) Gene trapped(7) Spontaneous(7)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Sgk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Sgk3 APN 1 9868384 missense probably damaging 1.00
IGL00906:Sgk3 APN 1 9877245 missense probably benign 0.00
IGL01683:Sgk3 APN 1 9881866 missense probably damaging 1.00
IGL02803:Sgk3 APN 1 9879048 missense possibly damaging 0.76
woolly UTSW 1 9886104 missense probably damaging 1.00
R0034:Sgk3 UTSW 1 9885677 missense probably damaging 1.00
R0034:Sgk3 UTSW 1 9885677 missense probably damaging 1.00
R0374:Sgk3 UTSW 1 9879081 splice site probably null
R0526:Sgk3 UTSW 1 9881579 missense probably damaging 1.00
R1483:Sgk3 UTSW 1 9872293 missense possibly damaging 0.80
R1992:Sgk3 UTSW 1 9880342 missense possibly damaging 0.52
R2073:Sgk3 UTSW 1 9891424 missense probably benign 0.01
R4590:Sgk3 UTSW 1 9898795 missense possibly damaging 0.94
R5436:Sgk3 UTSW 1 9881872 missense probably damaging 1.00
R5511:Sgk3 UTSW 1 9898686 intron probably benign
R5623:Sgk3 UTSW 1 9802295 intron probably benign
R5936:Sgk3 UTSW 1 9885820 intron probably benign
R6778:Sgk3 UTSW 1 9886144 critical splice donor site probably null
R6842:Sgk3 UTSW 1 9898754 missense probably benign
R7055:Sgk3 UTSW 1 9886059 missense probably damaging 1.00
R7186:Sgk3 UTSW 1 9886002 missense probably benign 0.00
R7336:Sgk3 UTSW 1 9884476 missense possibly damaging 0.88
R7429:Sgk3 UTSW 1 9872258 missense probably benign 0.00
R7430:Sgk3 UTSW 1 9872258 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTTGCAAAACGGAAACTGG -3'
(R):5'- TGAGGTCCACTGACTACTGTC -3'

Sequencing Primer
(F):5'- CGGAAACTGGATGGAAAATTTTATGC -3'
(R):5'- TCTCCAACGGCTGTCGGTAG -3'
Posted On2019-11-26