Incidental Mutation 'R7787:Nat10'
ID599571
Institutional Source Beutler Lab
Gene Symbol Nat10
Ensembl Gene ENSMUSG00000027185
Gene NameN-acetyltransferase 10
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7787 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location103721256-103761270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103721863 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1012 (D1012G)
Ref Sequence ENSEMBL: ENSMUSP00000028608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608] [ENSMUST00000076212]
Predicted Effect unknown
Transcript: ENSMUST00000028608
AA Change: D1012G
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: D1012G

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Nat10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nat10 APN 2 103725764 critical splice acceptor site probably null
IGL01062:Nat10 APN 2 103743048 missense probably damaging 1.00
IGL01524:Nat10 APN 2 103757757 missense probably damaging 1.00
IGL02553:Nat10 APN 2 103752668 missense probably damaging 1.00
IGL03040:Nat10 APN 2 103757265 splice site probably benign
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0268:Nat10 UTSW 2 103727917 splice site probably benign
R0422:Nat10 UTSW 2 103726729 nonsense probably null
R0423:Nat10 UTSW 2 103748227 missense probably damaging 0.98
R0788:Nat10 UTSW 2 103743115 missense probably damaging 1.00
R0946:Nat10 UTSW 2 103731374 missense probably damaging 0.99
R1353:Nat10 UTSW 2 103754073 missense possibly damaging 0.95
R2141:Nat10 UTSW 2 103731303 splice site probably null
R2142:Nat10 UTSW 2 103731303 splice site probably null
R2192:Nat10 UTSW 2 103726177 missense probably benign 0.00
R3904:Nat10 UTSW 2 103726247 splice site probably benign
R4183:Nat10 UTSW 2 103739813 missense probably damaging 1.00
R4496:Nat10 UTSW 2 103757739 missense probably damaging 1.00
R4578:Nat10 UTSW 2 103754072 missense probably damaging 1.00
R4589:Nat10 UTSW 2 103754070 missense probably damaging 1.00
R4639:Nat10 UTSW 2 103734889 missense probably benign 0.00
R4679:Nat10 UTSW 2 103732170 missense probably damaging 1.00
R4711:Nat10 UTSW 2 103748267 nonsense probably null
R5089:Nat10 UTSW 2 103757143 unclassified probably benign
R5103:Nat10 UTSW 2 103757260 missense probably damaging 0.97
R5108:Nat10 UTSW 2 103732203 missense probably damaging 0.97
R5134:Nat10 UTSW 2 103743293 missense probably benign 0.29
R5823:Nat10 UTSW 2 103730267 missense probably damaging 1.00
R5893:Nat10 UTSW 2 103721839 unclassified probably benign
R6135:Nat10 UTSW 2 103743316 missense probably damaging 1.00
R6455:Nat10 UTSW 2 103739886 missense possibly damaging 0.69
R6592:Nat10 UTSW 2 103754150 missense probably null 1.00
R6956:Nat10 UTSW 2 103734412 missense probably benign 0.01
R7036:Nat10 UTSW 2 103754108 missense probably benign 0.00
R7063:Nat10 UTSW 2 103748077 missense probably benign 0.01
R7172:Nat10 UTSW 2 103732969 missense probably damaging 1.00
R7226:Nat10 UTSW 2 103726753 missense probably benign 0.01
R7286:Nat10 UTSW 2 103754169 missense probably benign 0.02
R7448:Nat10 UTSW 2 103748045 missense probably damaging 0.99
R7470:Nat10 UTSW 2 103734881 missense probably benign 0.00
R7639:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7640:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7641:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7642:Nat10 UTSW 2 103726786 missense possibly damaging 0.94
R7766:Nat10 UTSW 2 103725707 missense probably benign 0.00
R7910:Nat10 UTSW 2 103725145 missense probably benign 0.26
R7991:Nat10 UTSW 2 103725145 missense probably benign 0.26
X0024:Nat10 UTSW 2 103727881 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAGCAGCCTGTTCAAGAGTG -3'
(R):5'- CAGAGAACATGTCTGGGTGTC -3'

Sequencing Primer
(F):5'- CAAGAGTGACTTTGTCTTCAGTCACG -3'
(R):5'- AGAACATGTCTGGGTGTCTGTCAG -3'
Posted On2019-11-26