Incidental Mutation 'R7787:Unc5c'
ID599579
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7787 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141768552 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 295 (G295D)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably damaging
Transcript: ENSMUST00000075282
AA Change: G295D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: G295D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106236
AA Change: G295D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: G295D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130636
AA Change: G221D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: G221D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142762
AA Change: G295D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: G295D

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7956:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7979:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGGTCCATATGCTGTGTG -3'
(R):5'- GAGGAATCTGACTTCTCAGCAAGG -3'

Sequencing Primer
(F):5'- CTGGTCCATATGCTGTGTGTTATTTG -3'
(R):5'- CTGACTTCTCAGCAAGGTAAATACTG -3'
Posted On2019-11-26