Incidental Mutation 'R7787:Mdn1'
ID599581
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32741794 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 3855 (L3855Q)
Ref Sequence ENSEMBL: ENSMUSP00000071569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably damaging
Transcript: ENSMUST00000071642
AA Change: L3855Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: L3855Q

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: L3855Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: L3855Q

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860 splice site probably benign
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32719223 missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32746527 missense probably benign 0.20
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32726942 critical splice donor site probably null
R6995:Mdn1 UTSW 4 32733374 missense probably benign 0.03
R7048:Mdn1 UTSW 4 32767969 missense probably benign 0.00
R7082:Mdn1 UTSW 4 32762341 missense probably benign
R7158:Mdn1 UTSW 4 32725121 missense probably benign 0.09
R7166:Mdn1 UTSW 4 32746446 missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32719184 missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32694634 missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32701823 missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32695427 missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32725944 missense probably benign 0.12
R7330:Mdn1 UTSW 4 32723685 missense probably benign 0.16
R7363:Mdn1 UTSW 4 32691729 missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32773375 missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32739030 missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32667270 critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32696359 missense probably benign 0.27
R7605:Mdn1 UTSW 4 32694599 missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32691229 missense probably benign 0.08
R7689:Mdn1 UTSW 4 32739912 missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32741344 missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32741344 missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32722360 missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32718420 missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32734421 missense probably benign
R8111:Mdn1 UTSW 4 32674003 missense possibly damaging 0.81
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32667102 missense probably benign 0.01
Z1176:Mdn1 UTSW 4 32668944 missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32696244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTACAGGTTTTATGTGGAAGTCG -3'
(R):5'- AAGCTCCTGGCAAGTCATAGC -3'

Sequencing Primer
(F):5'- GTCGTCCCTCTAAACATAATTTTTGC -3'
(R):5'- CTGGCAAGTCATAGCTTCACAGTG -3'
Posted On2019-11-26