Incidental Mutation 'R7787:Hyal6'
ID599587
Institutional Source Beutler Lab
Gene Symbol Hyal6
Ensembl Gene ENSMUSG00000029679
Gene Namehyaluronoglucosaminidase 6
Synonyms4932701A20Rik, Hyal-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24733245-24745452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24743736 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 477 (Y477C)
Ref Sequence ENSEMBL: ENSMUSP00000031690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031690] [ENSMUST00000031691]
Predicted Effect probably damaging
Transcript: ENSMUST00000031690
AA Change: Y477C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031690
Gene: ENSMUSG00000029679
AA Change: Y477C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 30 363 4.8e-136 PFAM
EGF 365 438 6.02e0 SMART
transmembrane domain 457 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031691
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Hyal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Hyal6 APN 6 24734179 missense probably damaging 1.00
IGL02269:Hyal6 APN 6 24740859 missense probably damaging 0.97
IGL02729:Hyal6 APN 6 24734695 missense probably damaging 1.00
IGL02793:Hyal6 APN 6 24734379 nonsense probably null
IGL02943:Hyal6 APN 6 24743439 missense probably damaging 0.99
IGL03351:Hyal6 APN 6 24743429 missense probably damaging 1.00
R0481:Hyal6 UTSW 6 24743418 missense probably damaging 1.00
R0517:Hyal6 UTSW 6 24734853 missense probably benign
R0853:Hyal6 UTSW 6 24734073 missense probably benign
R1182:Hyal6 UTSW 6 24743417 missense probably damaging 1.00
R1401:Hyal6 UTSW 6 24743435 missense probably damaging 1.00
R1780:Hyal6 UTSW 6 24734032 splice site probably benign
R1858:Hyal6 UTSW 6 24740858 missense probably benign 0.01
R2011:Hyal6 UTSW 6 24734724 missense possibly damaging 0.69
R3441:Hyal6 UTSW 6 24734593 missense probably benign
R4819:Hyal6 UTSW 6 24734966 nonsense probably null
R5357:Hyal6 UTSW 6 24734518 missense probably benign 0.05
R5648:Hyal6 UTSW 6 24734236 missense possibly damaging 0.61
R5717:Hyal6 UTSW 6 24743691 missense probably benign 0.15
R5884:Hyal6 UTSW 6 24743369 missense probably damaging 1.00
R6657:Hyal6 UTSW 6 24734758 missense possibly damaging 0.61
R6826:Hyal6 UTSW 6 24734372 missense probably damaging 1.00
R7178:Hyal6 UTSW 6 24734835 missense probably benign 0.28
R7531:Hyal6 UTSW 6 24740787 missense possibly damaging 0.46
R7630:Hyal6 UTSW 6 24734584 missense probably damaging 1.00
R7851:Hyal6 UTSW 6 24734498 missense probably benign 0.05
R8132:Hyal6 UTSW 6 24740828 missense possibly damaging 0.80
R8200:Hyal6 UTSW 6 24734566 missense probably benign 0.01
R8294:Hyal6 UTSW 6 24734379 missense possibly damaging 0.53
R8300:Hyal6 UTSW 6 24734088 missense probably benign
R8509:Hyal6 UTSW 6 24734606 missense probably damaging 1.00
R8705:Hyal6 UTSW 6 24734674 missense probably benign 0.01
X0019:Hyal6 UTSW 6 24734667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATGGATTTGTGTGCCACTG -3'
(R):5'- AGTACTTCCTAATGCCTTAAACCTG -3'

Sequencing Primer
(F):5'- CCACTGTTACTATGGCTGGCATG -3'
(R):5'- AACCATTGTCACTATCATATGTGTC -3'
Posted On2019-11-26