Incidental Mutation 'R7787:Edc4'
ID599595
Institutional Source Beutler Lab
Gene Symbol Edc4
Ensembl Gene ENSMUSG00000036270
Gene Nameenhancer of mRNA decapping 4
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7787 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105880881-105894908 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105887514 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 7 (Y7*)
Ref Sequence ENSEMBL: ENSMUSP00000118162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040254] [ENSMUST00000119261] [ENSMUST00000136048] [ENSMUST00000145618]
Predicted Effect probably null
Transcript: ENSMUST00000040254
AA Change: Y432*
SMART Domains Protein: ENSMUSP00000039134
Gene: ENSMUSG00000036270
AA Change: Y432*

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
coiled coil region 1001 1030 N/A INTRINSIC
low complexity region 1267 1285 N/A INTRINSIC
PDB:2VXG|B 1286 1402 3e-18 PDB
Predicted Effect probably null
Transcript: ENSMUST00000119261
AA Change: Y432*
SMART Domains Protein: ENSMUSP00000113854
Gene: ENSMUSG00000036270
AA Change: Y432*

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
coiled coil region 985 1014 N/A INTRINSIC
low complexity region 1251 1269 N/A INTRINSIC
PDB:2VXG|B 1270 1386 3e-18 PDB
Predicted Effect probably null
Transcript: ENSMUST00000132680
AA Change: Y11*
SMART Domains Protein: ENSMUSP00000114209
Gene: ENSMUSG00000036270
AA Change: Y11*

DomainStartEndE-ValueType
low complexity region 189 224 N/A INTRINSIC
low complexity region 245 273 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136048
AA Change: Y372*
SMART Domains Protein: ENSMUSP00000114285
Gene: ENSMUSG00000036270
AA Change: Y372*

DomainStartEndE-ValueType
Blast:WD40 33 93 9e-8 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
low complexity region 549 584 N/A INTRINSIC
low complexity region 604 632 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
low complexity region 961 990 N/A INTRINSIC
low complexity region 1215 1233 N/A INTRINSIC
PDB:2VXG|B 1234 1317 1e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139154
Predicted Effect probably null
Transcript: ENSMUST00000145618
AA Change: Y7*
SMART Domains Protein: ENSMUSP00000118162
Gene: ENSMUSG00000036270
AA Change: Y7*

DomainStartEndE-ValueType
low complexity region 185 220 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156357
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is thought to promote mRNA decay, and is known to interact with several mRNA decapping proteins. In humans, decreased expression of this gene prevents the accumulation of mRNA decapping proteins to mRNA processing bodies (P-body). Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Edc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Edc4 APN 8 105881123 missense probably damaging 1.00
IGL01069:Edc4 APN 8 105887134 missense probably benign 0.35
IGL01470:Edc4 APN 8 105889981 unclassified probably benign
IGL01656:Edc4 APN 8 105886377 missense possibly damaging 0.55
IGL01804:Edc4 APN 8 105890657 missense possibly damaging 0.92
IGL02135:Edc4 APN 8 105885822 missense probably damaging 1.00
IGL02825:Edc4 APN 8 105890611 missense probably damaging 1.00
IGL03036:Edc4 APN 8 105887311 unclassified probably null
IGL03401:Edc4 APN 8 105887514 nonsense probably null
IGL03409:Edc4 APN 8 105885116 missense probably damaging 1.00
Armor UTSW 8 105890867 missense probably damaging 1.00
mail UTSW 8 105886309 splice site probably null
R0362:Edc4 UTSW 8 105886775 missense probably damaging 1.00
R0541:Edc4 UTSW 8 105889428 missense probably benign 0.00
R0614:Edc4 UTSW 8 105889396 missense possibly damaging 0.93
R0631:Edc4 UTSW 8 105890792 missense possibly damaging 0.57
R1067:Edc4 UTSW 8 105891005 missense probably damaging 0.97
R1270:Edc4 UTSW 8 105891264 missense possibly damaging 0.90
R1371:Edc4 UTSW 8 105890750 unclassified probably benign
R1384:Edc4 UTSW 8 105892382 missense probably damaging 1.00
R1417:Edc4 UTSW 8 105887855 critical splice donor site probably null
R1423:Edc4 UTSW 8 105891211 unclassified probably benign
R1446:Edc4 UTSW 8 105888132 missense probably damaging 0.96
R1472:Edc4 UTSW 8 105892828 missense probably damaging 0.99
R1797:Edc4 UTSW 8 105891085 missense probably benign 0.03
R2086:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R2092:Edc4 UTSW 8 105887528 missense probably damaging 1.00
R3079:Edc4 UTSW 8 105885118 missense possibly damaging 0.86
R3551:Edc4 UTSW 8 105885494 missense probably damaging 1.00
R4492:Edc4 UTSW 8 105885068 frame shift probably null
R4650:Edc4 UTSW 8 105892675 nonsense probably null
R4735:Edc4 UTSW 8 105887186 missense probably damaging 1.00
R4854:Edc4 UTSW 8 105887925 intron probably benign
R5530:Edc4 UTSW 8 105889254 nonsense probably null
R5851:Edc4 UTSW 8 105890867 missense probably damaging 1.00
R5889:Edc4 UTSW 8 105888022 missense possibly damaging 0.87
R5903:Edc4 UTSW 8 105890587 missense probably benign 0.04
R5996:Edc4 UTSW 8 105887401 missense probably damaging 1.00
R6078:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6079:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6143:Edc4 UTSW 8 105885874 missense probably damaging 1.00
R7072:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R7211:Edc4 UTSW 8 105886309 splice site probably null
R7368:Edc4 UTSW 8 105888405 small deletion probably benign
R7429:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7430:Edc4 UTSW 8 105891584 missense probably damaging 1.00
RF009:Edc4 UTSW 8 105889180 missense probably benign 0.27
RF014:Edc4 UTSW 8 105884600 missense probably benign
U15987:Edc4 UTSW 8 105887548 missense probably benign 0.01
X0018:Edc4 UTSW 8 105887001 missense probably damaging 1.00
X0063:Edc4 UTSW 8 105884580 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTCAGCTCAGTGAGTGTGC -3'
(R):5'- CAACGTATAATCCTGCCCCTG -3'

Sequencing Primer
(F):5'- TCAGTGAGTGTGCCTCCCAG -3'
(R):5'- TGGGCAACTCACCGGTC -3'
Posted On2019-11-26