Incidental Mutation 'R7787:Terf2ip'
ID599596
Institutional Source Beutler Lab
Gene Symbol Terf2ip
Ensembl Gene ENSMUSG00000033430
Gene Nametelomeric repeat binding factor 2, interacting protein
SynonymsRap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location112011398-112020528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112015455 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 260 (E260D)
Ref Sequence ENSEMBL: ENSMUSP00000052170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000052138] [ENSMUST00000071732] [ENSMUST00000093120] [ENSMUST00000164470] [ENSMUST00000211990]
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052138
AA Change: E260D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052170
Gene: ENSMUSG00000033430
AA Change: E260D

DomainStartEndE-ValueType
Pfam:BRCT_2 17 100 1.4e-23 PFAM
Pfam:Myb_DNA-bind_2 129 193 3.9e-35 PFAM
low complexity region 279 298 N/A INTRINSIC
Pfam:Rap1_C 315 392 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071732
SMART Domains Protein: ENSMUSP00000128163
Gene: ENSMUSG00000092086

DomainStartEndE-ValueType
RRM 14 86 3.1e-26 SMART
RRM 105 177 8.1e-24 SMART
low complexity region 192 310 N/A INTRINSIC
low complexity region 321 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211990
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. Mice homozygous for a gene trapped allele die prior to E6.5 while heterozygous mice are resistant to LPS-induced mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Terf2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Terf2ip APN 8 112012068 missense probably benign
R0244:Terf2ip UTSW 8 112018164 missense possibly damaging 0.73
R0544:Terf2ip UTSW 8 112015342 missense possibly damaging 0.88
R0617:Terf2ip UTSW 8 112011495 missense probably benign 0.10
R0976:Terf2ip UTSW 8 112011717 missense probably damaging 0.98
R1709:Terf2ip UTSW 8 112011606 frame shift probably null
R2078:Terf2ip UTSW 8 112015403 missense probably benign 0.02
R2134:Terf2ip UTSW 8 112011639 missense possibly damaging 0.71
R4572:Terf2ip UTSW 8 112012017 missense probably damaging 1.00
R6172:Terf2ip UTSW 8 112018017 missense probably damaging 1.00
R6266:Terf2ip UTSW 8 112011915 missense probably damaging 1.00
R6563:Terf2ip UTSW 8 112018202 missense probably damaging 1.00
R7180:Terf2ip UTSW 8 112011420 unclassified probably benign
R7203:Terf2ip UTSW 8 112017986 missense probably benign 0.30
R7222:Terf2ip UTSW 8 112011915 missense possibly damaging 0.64
R7304:Terf2ip UTSW 8 112011648 missense possibly damaging 0.86
R7938:Terf2ip UTSW 8 112012085 missense possibly damaging 0.87
R8089:Terf2ip UTSW 8 112011792 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCACAGAACTGATGCAGACG -3'
(R):5'- AAAATTGTCCCTATTCGGTGTGATG -3'

Sequencing Primer
(F):5'- ACTGATGCAGACGGTCTATGC -3'
(R):5'- CGGTGTGATGATTTTTCTCCCTCAG -3'
Posted On2019-11-26