Incidental Mutation 'R7787:Itgb1'
ID599597
Institutional Source Beutler Lab
Gene Symbol Itgb1
Ensembl Gene ENSMUSG00000025809
Gene Nameintegrin beta 1 (fibronectin receptor beta)
SynonymsGm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location128685654-128733200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128727018 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 99 (N99K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]
Predicted Effect probably benign
Transcript: ENSMUST00000090006
SMART Domains Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PSI 26 76 3.01e-7 SMART
INB 34 464 2e-298 SMART
VWA 142 372 1.45e0 SMART
low complexity region 568 581 N/A INTRINSIC
Pfam:EGF_2 599 630 8.8e-8 PFAM
Integrin_B_tail 640 728 4.58e-37 SMART
transmembrane domain 729 751 N/A INTRINSIC
Integrin_b_cyt 752 798 3.43e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124826
SMART Domains Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3VI4|D 21 51 2e-16 PDB
Blast:PSI 26 51 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149116
AA Change: N99K

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119699
Gene: ENSMUSG00000025809
AA Change: N99K

DomainStartEndE-ValueType
Pfam:Integrin_B_tail 1 39 1.9e-12 PFAM
transmembrane domain 40 62 N/A INTRINSIC
Integrin_b_cyt 63 109 8.77e-25 SMART
Meta Mutation Damage Score 0.1003 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Itgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Itgb1 APN 8 128713918 splice site probably benign
IGL01407:Itgb1 APN 8 128722834 missense probably benign 0.08
IGL03025:Itgb1 APN 8 128722584 missense possibly damaging 0.96
Drystacked UTSW 8 128732054 missense possibly damaging 0.79
Jumble UTSW 8 128714116 missense probably damaging 1.00
PIT4377001:Itgb1 UTSW 8 128710383 missense probably damaging 1.00
R0136:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0244:Itgb1 UTSW 8 128717685 splice site probably benign
R0483:Itgb1 UTSW 8 128726167 missense possibly damaging 0.79
R0606:Itgb1 UTSW 8 128722372 unclassified probably benign
R0657:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0865:Itgb1 UTSW 8 128710251 critical splice acceptor site probably null
R1052:Itgb1 UTSW 8 128713305 missense probably damaging 1.00
R1429:Itgb1 UTSW 8 128717676 critical splice donor site probably null
R1589:Itgb1 UTSW 8 128705458 missense probably damaging 0.99
R1589:Itgb1 UTSW 8 128705459 missense possibly damaging 0.95
R1614:Itgb1 UTSW 8 128720065 missense probably damaging 1.00
R1672:Itgb1 UTSW 8 128732045 missense probably damaging 1.00
R1723:Itgb1 UTSW 8 128726038 missense probably damaging 0.98
R1865:Itgb1 UTSW 8 128720457 missense probably benign 0.01
R3786:Itgb1 UTSW 8 128713358 missense probably damaging 1.00
R4223:Itgb1 UTSW 8 128714143 missense probably damaging 1.00
R4756:Itgb1 UTSW 8 128717222 missense probably damaging 0.98
R4826:Itgb1 UTSW 8 128720308 missense probably damaging 1.00
R4880:Itgb1 UTSW 8 128716150 missense probably damaging 1.00
R5202:Itgb1 UTSW 8 128720010 missense probably damaging 0.99
R5682:Itgb1 UTSW 8 128727068 splice site probably null
R5935:Itgb1 UTSW 8 128713237 nonsense probably null
R6156:Itgb1 UTSW 8 128732054 missense possibly damaging 0.79
R6160:Itgb1 UTSW 8 128720283 missense possibly damaging 0.95
R6248:Itgb1 UTSW 8 128722421 missense possibly damaging 0.80
R6812:Itgb1 UTSW 8 128705410 splice site probably null
R6869:Itgb1 UTSW 8 128720035 missense probably benign 0.01
R7249:Itgb1 UTSW 8 128720404 missense probably benign 0.28
R7496:Itgb1 UTSW 8 128720305 missense probably benign
R7679:Itgb1 UTSW 8 128720448 missense probably damaging 0.99
R7800:Itgb1 UTSW 8 128713237 missense possibly damaging 0.89
R8015:Itgb1 UTSW 8 128722401 missense possibly damaging 0.79
R8687:Itgb1 UTSW 8 128716216 missense probably damaging 1.00
R8709:Itgb1 UTSW 8 128713406 intron probably benign
Z1088:Itgb1 UTSW 8 128713369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTAGTTGGATAAATGTTGCCTC -3'
(R):5'- TGGTAAAGTCCTTCCAAGCAC -3'

Sequencing Primer
(F):5'- CATTTTGACACACTACAGTTAGGTTG -3'
(R):5'- GTCCTTCCAAGCACTAAGTTAAC -3'
Posted On2019-11-26