Incidental Mutation 'R7787:Dock4'
ID 599611
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 045843-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R7787 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40775676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 540 (T540A)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: T540A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: T540A

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: T540A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,263,926 (GRCm39) I38N probably damaging Het
Abcb4 G A 5: 8,959,220 (GRCm39) V216M probably damaging Het
Abcc2 G A 19: 43,772,685 (GRCm39) V32M probably damaging Het
Adgrb3 C A 1: 25,471,625 (GRCm39) V714F probably damaging Het
Ahnak T A 19: 8,986,679 (GRCm39) D2654E unknown Het
Ak8 T A 2: 28,602,324 (GRCm39) I86N probably damaging Het
Apob G A 12: 8,040,780 (GRCm39) R635Q probably damaging Het
Atp10b G A 11: 43,150,700 (GRCm39) R1466H possibly damaging Het
Bltp1 A C 3: 36,939,557 (GRCm39) H137P probably damaging Het
Btnl9 T C 11: 49,066,866 (GRCm39) T252A unknown Het
Cacna1e T A 1: 154,358,314 (GRCm39) I648F probably damaging Het
Camkk1 A G 11: 72,917,412 (GRCm39) D121G probably benign Het
Cc2d1a C A 8: 84,860,144 (GRCm39) Q904H possibly damaging Het
Cd1d1 A G 3: 86,904,903 (GRCm39) S212P probably damaging Het
Cfap69 C T 5: 5,639,260 (GRCm39) C638Y probably damaging Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Clca4a A G 3: 144,659,594 (GRCm39) V754A probably benign Het
Cnpy4 T A 5: 138,190,900 (GRCm39) H187Q probably benign Het
Cpne5 A T 17: 29,407,261 (GRCm39) probably null Het
Crnkl1 A T 2: 145,767,515 (GRCm39) N359K probably benign Het
Cyb561 A T 11: 105,828,466 (GRCm39) L63H probably damaging Het
Edc4 T A 8: 106,614,146 (GRCm39) Y7* probably null Het
Fstl5 A C 3: 76,337,131 (GRCm39) D230A probably damaging Het
Fthl17b C T X: 8,829,043 (GRCm39) R9Q possibly damaging Het
Fthl17b C T X: 8,829,047 (GRCm39) V8M possibly damaging Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Hecw1 T C 13: 14,493,494 (GRCm39) Q337R probably damaging Het
Hmcn1 A T 1: 150,632,343 (GRCm39) Y865N probably damaging Het
Hyal6 A G 6: 24,743,735 (GRCm39) Y477C probably damaging Het
Ifi205 C T 1: 173,842,640 (GRCm39) G352E probably damaging Het
Ifi205 T A 1: 173,842,644 (GRCm39) S351C probably damaging Het
Irak3 C A 10: 120,012,256 (GRCm39) Q169H probably benign Het
Itgb1 T A 8: 129,453,499 (GRCm39) N99K probably benign Het
Kng2 A G 16: 22,818,598 (GRCm39) F298S probably damaging Het
Kri1 T C 9: 21,192,380 (GRCm39) E256G Het
Lamc3 T C 2: 31,790,551 (GRCm39) I257T probably damaging Het
Mas1 A C 17: 13,061,374 (GRCm39) N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 (GRCm39) L3855Q probably damaging Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mybph G A 1: 134,125,246 (GRCm39) G258D probably benign Het
Mycbp2 A C 14: 103,364,533 (GRCm39) H4358Q probably damaging Het
Nat10 T C 2: 103,552,208 (GRCm39) D1012G unknown Het
Nub1 C A 5: 24,913,801 (GRCm39) Q561K probably benign Het
Nynrin A G 14: 56,107,980 (GRCm39) N1029S probably benign Het
Or52x1 A T 7: 104,853,252 (GRCm39) C99* probably null Het
Or56a4 T G 7: 104,806,401 (GRCm39) I163L probably benign Het
Or5k15 A G 16: 58,709,953 (GRCm39) F210S probably benign Het
Or6e1 A G 14: 54,520,169 (GRCm39) L61P probably damaging Het
Or8g19 C T 9: 39,055,548 (GRCm39) L51F probably benign Het
Pcsk1 T A 13: 75,280,277 (GRCm39) Y701N possibly damaging Het
Pglyrp4 C G 3: 90,640,295 (GRCm39) H182D probably damaging Het
Phaf1 T G 8: 105,957,820 (GRCm39) V42G probably damaging Het
Pkp4 C A 2: 59,152,881 (GRCm39) D576E probably damaging Het
Plec A G 15: 76,083,811 (GRCm39) V17A unknown Het
Polq T A 16: 36,837,671 (GRCm39) N194K probably damaging Het
Pou4f1 A T 14: 104,703,460 (GRCm39) M324K unknown Het
Ppa2 G T 3: 133,036,259 (GRCm39) G138W probably damaging Het
Prob1 A T 18: 35,785,285 (GRCm39) F990I possibly damaging Het
Proser1 T A 3: 53,380,969 (GRCm39) I182N probably damaging Het
Sgk3 T C 1: 9,952,016 (GRCm39) L214P probably damaging Het
Sipa1l1 T C 12: 82,496,762 (GRCm39) S1765P possibly damaging Het
Slc15a2 G A 16: 36,572,228 (GRCm39) S712L probably benign Het
Slc38a9 T C 13: 112,825,880 (GRCm39) L106P probably damaging Het
Slc43a2 G A 11: 75,453,900 (GRCm39) R271H probably damaging Het
Spsb4 T A 9: 96,877,643 (GRCm39) I227F probably damaging Het
Srgap3 C T 6: 112,752,520 (GRCm39) M321I probably benign Het
Stam2 T C 2: 52,596,418 (GRCm39) I340V probably benign Het
Tbc1d5 T A 17: 51,181,711 (GRCm39) R341* probably null Het
Terf2ip A C 8: 112,742,087 (GRCm39) E260D probably damaging Het
Tert G T 13: 73,797,051 (GRCm39) K1096N probably damaging Het
Ttc32 T A 12: 9,088,083 (GRCm39) D103E probably benign Het
Ube3d T A 9: 86,254,395 (GRCm39) Q362L possibly damaging Het
Unc5c G A 3: 141,474,313 (GRCm39) G295D probably damaging Het
Wnt7b T A 15: 85,428,112 (GRCm39) I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 (GRCm39) probably null Het
Zfp619 A G 7: 39,186,226 (GRCm39) Q752R possibly damaging Het
Zkscan3 T C 13: 21,572,034 (GRCm39) K533E possibly damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTCAACTCAGATTGATCGG -3'
(R):5'- TACAGTTCCCACGTGCCCTTAG -3'

Sequencing Primer
(F):5'- CTCAGATTGATCGGAGTCCAAATTTC -3'
(R):5'- ACGTGCCCTTAGGTCGGAG -3'
Posted On 2019-11-26