Incidental Mutation 'R7787:Tert'
ID599615
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73648932 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1096 (K1096N)
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably damaging
Transcript: ENSMUST00000022104
AA Change: K1096N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611
AA Change: K1096N

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221522
Predicted Effect probably benign
Transcript: ENSMUST00000223303
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc15a2 G A 16: 36,751,866 S712L probably benign Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
galileo UTSW 13 73627606 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R0829:Tert UTSW 13 73644385 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5013:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5680:Tert UTSW 13 73642351 splice site probably null
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
R7747:Tert UTSW 13 73627606 missense probably damaging 1.00
R7846:Tert UTSW 13 73628195 missense probably damaging 1.00
R7994:Tert UTSW 13 73648955 missense probably benign 0.20
R8042:Tert UTSW 13 73627145 missense probably damaging 1.00
R8044:Tert UTSW 13 73635449 missense probably damaging 1.00
R8867:Tert UTSW 13 73628447 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGATTGTCAAGCTTGAGG -3'
(R):5'- CACAGAGGTTTGGAGGATGACC -3'

Sequencing Primer
(F):5'- CCAGATTGTCAAGCTTGAGGTCTTTG -3'
(R):5'- GGATGACCTAGCCTCACAACTG -3'
Posted On2019-11-26