Incidental Mutation 'R7787:Slc15a2'
ID599626
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Namesolute carrier family 15 (H+/peptide transporter), member 2
Synonyms8430408C16Rik, Pept2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7787 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location36750177-36784962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36751866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 712 (S712L)
Ref Sequence ENSEMBL: ENSMUSP00000023616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]
Predicted Effect probably benign
Transcript: ENSMUST00000023616
AA Change: S712L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: S712L

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165531
AA Change: S681L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: S681L

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,564,501 I38N probably damaging Het
4932438A13Rik A C 3: 36,885,408 H137P probably damaging Het
Abcb4 G A 5: 8,909,220 V216M probably damaging Het
Abcc2 G A 19: 43,784,246 V32M probably damaging Het
Adgrb3 C A 1: 25,432,544 V714F probably damaging Het
Ahnak T A 19: 9,009,315 D2654E unknown Het
Ak8 T A 2: 28,712,312 I86N probably damaging Het
Apob G A 12: 7,990,780 R635Q probably damaging Het
Atp10b G A 11: 43,259,873 R1466H possibly damaging Het
Btnl9 T C 11: 49,176,039 T252A unknown Het
Cacna1e T A 1: 154,482,568 I648F probably damaging Het
Camkk1 A G 11: 73,026,586 D121G probably benign Het
Cc2d1a C A 8: 84,133,515 Q904H possibly damaging Het
Cd1d1 A G 3: 86,997,596 S212P probably damaging Het
Cfap69 C T 5: 5,589,260 C638Y probably damaging Het
Clca4a A G 3: 144,953,833 V754A probably benign Het
Cnpy4 T A 5: 138,192,638 H187Q probably benign Het
Cpne5 A T 17: 29,188,287 probably null Het
Crnkl1 A T 2: 145,925,595 N359K probably benign Het
Cyb561 A T 11: 105,937,640 L63H probably damaging Het
D230025D16Rik T G 8: 105,231,188 V42G probably damaging Het
Dock4 A G 12: 40,725,677 T540A probably benign Het
Edc4 T A 8: 105,887,514 Y7* probably null Het
Fstl5 A C 3: 76,429,824 D230A probably damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hecw1 T C 13: 14,318,909 Q337R probably damaging Het
Hmcn1 A T 1: 150,756,592 Y865N probably damaging Het
Hyal6 A G 6: 24,743,736 Y477C probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 C T 1: 174,015,074 G352E probably damaging Het
Ifi205 T A 1: 174,015,078 S351C probably damaging Het
Irak3 C A 10: 120,176,351 Q169H probably benign Het
Itgb1 T A 8: 128,727,018 N99K probably benign Het
Kng2 A G 16: 22,999,848 F298S probably damaging Het
Kri1 T C 9: 21,281,084 E256G Het
Lamc3 T C 2: 31,900,539 I257T probably damaging Het
Mas1 A C 17: 12,842,487 N16K possibly damaging Het
Mdn1 T A 4: 32,741,794 L3855Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mybph G A 1: 134,197,508 G258D probably benign Het
Mycbp2 A C 14: 103,127,097 H4358Q probably damaging Het
Nat10 T C 2: 103,721,863 D1012G unknown Het
Nub1 C A 5: 24,708,803 Q561K probably benign Het
Nynrin A G 14: 55,870,523 N1029S probably benign Het
Olfr178 A G 16: 58,889,590 F210S probably benign Het
Olfr27 C T 9: 39,144,252 L51F probably benign Het
Olfr49 A G 14: 54,282,712 L61P probably damaging Het
Olfr684 T G 7: 105,157,194 I163L probably benign Het
Olfr686 A T 7: 105,204,045 C99* probably null Het
Pcsk1 T A 13: 75,132,158 Y701N possibly damaging Het
Pglyrp4 C G 3: 90,732,988 H182D probably damaging Het
Pkp4 C A 2: 59,322,537 D576E probably damaging Het
Plec A G 15: 76,199,611 V17A unknown Het
Polq T A 16: 37,017,309 N194K probably damaging Het
Pou4f1 A T 14: 104,466,024 M324K unknown Het
Ppa2 G T 3: 133,330,498 G138W probably damaging Het
Prob1 A T 18: 35,652,232 F990I possibly damaging Het
Proser1 T A 3: 53,473,548 I182N probably damaging Het
Sgk3 T C 1: 9,881,791 L214P probably damaging Het
Sipa1l1 T C 12: 82,449,988 S1765P possibly damaging Het
Slc38a9 T C 13: 112,689,346 L106P probably damaging Het
Slc43a2 G A 11: 75,563,074 R271H probably damaging Het
Spsb4 T A 9: 96,995,590 I227F probably damaging Het
Srgap3 C T 6: 112,775,559 M321I probably benign Het
Stam2 T C 2: 52,706,406 I340V probably benign Het
Tbc1d5 T A 17: 50,874,683 R341* probably null Het
Terf2ip A C 8: 112,015,455 E260D probably damaging Het
Tert G T 13: 73,648,932 K1096N probably damaging Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Ube2cbp T A 9: 86,372,342 Q362L possibly damaging Het
Unc5c G A 3: 141,768,552 G295D probably damaging Het
Wnt7b T A 15: 85,543,911 I117F probably damaging Het
Zcchc7 T C 4: 44,895,043 probably null Het
Zfp619 A G 7: 39,536,802 Q752R possibly damaging Het
Zkscan3 T C 13: 21,387,864 K533E possibly damaging Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36753775 missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36757791 missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36751880 nonsense probably null
IGL01511:Slc15a2 APN 16 36784726 missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36756230 missense probably benign
IGL02069:Slc15a2 APN 16 36759251 missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36762381 missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36760087 missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36751775 splice site probably null
IGL02507:Slc15a2 APN 16 36781659 missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36757193 missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36751905 missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36756048 critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36772043 missense probably benign
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0058:Slc15a2 UTSW 16 36754547 missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36782283 missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36753036 missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36774635 missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36775598 missense probably benign 0.00
R0619:Slc15a2 UTSW 16 36759307 missense probably damaging 1.00
R0963:Slc15a2 UTSW 16 36774573 missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36757139 missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36784643 splice site probably benign
R1471:Slc15a2 UTSW 16 36753791 missense probably damaging 0.99
R1569:Slc15a2 UTSW 16 36756383 missense probably benign 0.00
R1616:Slc15a2 UTSW 16 36754481 missense probably benign
R2246:Slc15a2 UTSW 16 36762361 missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36751837 nonsense probably null
R3834:Slc15a2 UTSW 16 36772128 nonsense probably null
R3835:Slc15a2 UTSW 16 36772128 nonsense probably null
R3885:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36782304 missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36782393 intron probably benign
R4108:Slc15a2 UTSW 16 36782393 intron probably benign
R4254:Slc15a2 UTSW 16 36754490 missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36772028 missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36757849 missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36772136 missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36781695 nonsense probably null
R5151:Slc15a2 UTSW 16 36752297 missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36762385 missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36772110 nonsense probably null
R6003:Slc15a2 UTSW 16 36754548 missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36761611 missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36751782 missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36761870 missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36752321 missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36782298 missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36756281 missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36757811 missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36751845 missense probably benign 0.01
R7545:Slc15a2 UTSW 16 36775602 missense probably damaging 1.00
R7559:Slc15a2 UTSW 16 36751897 missense probably benign
R7611:Slc15a2 UTSW 16 36756311 missense probably benign 0.18
R7825:Slc15a2 UTSW 16 36753034 missense possibly damaging 0.94
R8324:Slc15a2 UTSW 16 36759307 missense probably damaging 1.00
T0722:Slc15a2 UTSW 16 36772445 missense probably benign
V8831:Slc15a2 UTSW 16 36772445 missense probably benign
X0066:Slc15a2 UTSW 16 36753789 nonsense probably null
Z1088:Slc15a2 UTSW 16 36772445 missense probably benign
Z1176:Slc15a2 UTSW 16 36759316 critical splice acceptor site probably null
Z1176:Slc15a2 UTSW 16 36772445 missense probably benign
Z1177:Slc15a2 UTSW 16 36772445 missense probably benign
Z1177:Slc15a2 UTSW 16 36784687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCTCTAACCTGGCCAGAG -3'
(R):5'- GAACCTAGCGTTCTGCCAAG -3'

Sequencing Primer
(F):5'- CCATCCAGTGAGTCATCA -3'
(R):5'- GGAAATGCCTCCAAGTGATGATTCC -3'
Posted On2019-11-26