Incidental Mutation 'R7788:Tmem156'
ID599650
Institutional Source Beutler Lab
Gene Symbol Tmem156
Ensembl Gene ENSMUSG00000037913
Gene Nametransmembrane protein 156
SynonymsLOC243025
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7788 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65054346-65092132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65075569 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 217 (V217I)
Ref Sequence ENSEMBL: ENSMUSP00000148480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043352] [ENSMUST00000212080] [ENSMUST00000212194] [ENSMUST00000212640]
Predicted Effect probably benign
Transcript: ENSMUST00000043352
AA Change: V205I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044102
Gene: ENSMUSG00000037913
AA Change: V205I

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:TMEM156 39 264 1.2e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212080
AA Change: V217I

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212194
AA Change: V182I

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212640
AA Change: V153I

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,593 H473L possibly damaging Het
Adam7 A T 14: 68,512,645 V442E possibly damaging Het
Adgrv1 A T 13: 81,573,314 V715D probably damaging Het
Aldh1l1 A C 6: 90,569,912 D399A probably benign Het
Ankrd23 T C 1: 36,531,727 N274S probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Arpc4 A T 6: 113,385,604 M149L probably benign Het
Bdp1 T C 13: 100,055,251 T1407A possibly damaging Het
Calml3 A T 13: 3,804,121 I28N probably damaging Het
Cdhr3 A G 12: 33,060,320 S322P probably damaging Het
Cntn5 A G 9: 9,704,929 S622P probably benign Het
Col22a1 A G 15: 71,952,317 probably null Het
Csf2rb2 A T 15: 78,292,841 I143N probably benign Het
Cwh43 T C 5: 73,415,034 L205P probably damaging Het
Dennd5b T C 6: 149,068,566 T52A probably benign Het
Dhx40 A G 11: 86,775,676 I597T possibly damaging Het
Dnajc21 A G 15: 10,460,047 L268P probably damaging Het
Dzip1 A T 14: 118,883,393 D717E probably benign Het
Elmo3 A G 8: 105,308,244 N389D probably damaging Het
Evi2a T C 11: 79,527,942 E14G unknown Het
Fam149a T A 8: 45,381,517 R82W probably damaging Het
Farp1 A T 14: 121,276,253 E820V probably benign Het
Fgd5 T A 6: 91,988,459 S400T possibly damaging Het
Flnc G A 6: 29,456,444 V2214I possibly damaging Het
Galnt4 C A 10: 99,109,113 N233K possibly damaging Het
Gbp5 A G 3: 142,503,080 Y128C probably damaging Het
Gm12394 A T 4: 42,793,546 H195Q possibly damaging Het
Gm4871 G A 5: 145,032,610 T33I probably benign Het
Gm5592 T C 7: 41,286,694 S207P probably benign Het
Gm9573 A T 17: 35,618,906 S1463T unknown Het
Gtf2ird1 A T 5: 134,417,131 C15* probably null Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ido2 T A 8: 24,547,226 I155F probably damaging Het
Ifi27l2b A T 12: 103,457,009 probably null Het
Il15ra C T 2: 11,723,593 T49I probably damaging Het
Itpr3 T A 17: 27,118,597 C2460* probably null Het
Kcnj11 T C 7: 46,099,755 N48S probably damaging Het
Lmo7 A C 14: 101,898,576 N695T possibly damaging Het
Mmp15 C A 8: 95,368,148 H217N probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myo5c A T 9: 75,279,345 D991V probably damaging Het
Nfkbid T A 7: 30,427,178 N396K probably damaging Het
Oas1c A G 5: 120,801,042 F361L probably benign Het
Olfr22-ps1 A T 11: 73,955,122 Y144F probably benign Het
Olfr433 A G 1: 174,042,084 I45V probably benign Het
Osbpl9 T C 4: 109,062,494 K606E probably benign Het
Pkp2 C A 16: 16,225,408 L111I probably benign Het
Pogz A G 3: 94,875,233 Y635C probably damaging Het
Prdx2 A G 8: 84,971,674 T165A probably benign Het
Ptcd3 T C 6: 71,885,557 I465V probably benign Het
Ptprd G A 4: 75,998,604 T770I probably damaging Het
Rapgef6 A G 11: 54,694,399 Y1541C probably damaging Het
Rilpl1 A T 5: 124,496,137 probably null Het
Rimbp3 T A 16: 17,212,704 Y1331N probably benign Het
Sav1 T C 12: 69,984,221 R176G probably damaging Het
Sirt5 A G 13: 43,383,147 H219R probably benign Het
Skint5 T G 4: 113,546,518 D1169A unknown Het
Slfn9 G T 11: 82,982,641 Q479K possibly damaging Het
Soga1 C T 2: 157,027,584 A1044T probably benign Het
Susd4 T C 1: 182,895,202 I483T possibly damaging Het
Tmem79 A G 3: 88,332,642 Y254H probably benign Het
Tmprss2 T A 16: 97,576,229 K223* probably null Het
Trav3-1 T C 14: 52,581,124 V85A probably damaging Het
Ttn T C 2: 76,885,756 probably null Het
Vmn2r22 T C 6: 123,637,600 I344V not run Het
Vps13c A T 9: 67,940,483 M2176L probably benign Het
Wdfy3 A T 5: 101,848,357 V3213D probably damaging Het
Zbtb21 G A 16: 97,951,454 T543M possibly damaging Het
Zc3hav1 A T 6: 38,332,756 V377D probably benign Het
Zswim3 T C 2: 164,819,779 C60R probably damaging Het
Other mutations in Tmem156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Tmem156 APN 5 65073840 missense probably damaging 1.00
IGL01064:Tmem156 APN 5 65079984 missense probably damaging 0.99
IGL01330:Tmem156 APN 5 65080182 missense probably benign 0.17
IGL03336:Tmem156 APN 5 65075764 missense probably benign 0.01
IGL03383:Tmem156 APN 5 65075697 missense probably damaging 0.98
R0526:Tmem156 UTSW 5 65075818 missense probably benign 0.02
R2006:Tmem156 UTSW 5 65079951 missense probably damaging 1.00
R4721:Tmem156 UTSW 5 65091527 missense probably benign 0.10
R4773:Tmem156 UTSW 5 65080159 missense probably damaging 1.00
R4810:Tmem156 UTSW 5 65091447 intron probably benign
R4910:Tmem156 UTSW 5 65091462 intron probably benign
R5148:Tmem156 UTSW 5 65073768 missense probably benign 0.00
R5510:Tmem156 UTSW 5 65075574 missense probably benign 0.02
R5809:Tmem156 UTSW 5 65075607 missense possibly damaging 0.55
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R7731:Tmem156 UTSW 5 65075562 critical splice donor site probably null
R7772:Tmem156 UTSW 5 65080174 missense probably damaging 1.00
R7979:Tmem156 UTSW 5 65080009 missense possibly damaging 0.47
R8017:Tmem156 UTSW 5 65073861 missense probably damaging 1.00
R8132:Tmem156 UTSW 5 65075755 missense probably benign 0.00
R8249:Tmem156 UTSW 5 65075626 nonsense probably null
RF020:Tmem156 UTSW 5 65091547 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TATCTCCGATTATGGTTGAGTCCC -3'
(R):5'- CATCACCGCCGCTCTTATAG -3'

Sequencing Primer
(F):5'- ACTTCCGGTGACATTTGG -3'
(R):5'- TCTTATAGCTGACCCTGTGAAGGAAG -3'
Posted On2019-11-26