Incidental Mutation 'R7788:Mmp15'
ID599671
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Namematrix metallopeptidase 15
SynonymsMembrane type 2-MMP, MT2-MMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7788 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location95352268-95375080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95368148 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 217 (H217N)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
Predicted Effect probably damaging
Transcript: ENSMUST00000034243
AA Change: H217N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: H217N

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,593 H473L possibly damaging Het
Adam7 A T 14: 68,512,645 V442E possibly damaging Het
Adgrv1 A T 13: 81,573,314 V715D probably damaging Het
Aldh1l1 A C 6: 90,569,912 D399A probably benign Het
Ankrd23 T C 1: 36,531,727 N274S probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Arpc4 A T 6: 113,385,604 M149L probably benign Het
Bdp1 T C 13: 100,055,251 T1407A possibly damaging Het
Calml3 A T 13: 3,804,121 I28N probably damaging Het
Cdhr3 A G 12: 33,060,320 S322P probably damaging Het
Cntn5 A G 9: 9,704,929 S622P probably benign Het
Col22a1 A G 15: 71,952,317 probably null Het
Csf2rb2 A T 15: 78,292,841 I143N probably benign Het
Cwh43 T C 5: 73,415,034 L205P probably damaging Het
Dennd5b T C 6: 149,068,566 T52A probably benign Het
Dhx40 A G 11: 86,775,676 I597T possibly damaging Het
Dnajc21 A G 15: 10,460,047 L268P probably damaging Het
Dzip1 A T 14: 118,883,393 D717E probably benign Het
Elmo3 A G 8: 105,308,244 N389D probably damaging Het
Evi2a T C 11: 79,527,942 E14G unknown Het
Fam149a T A 8: 45,381,517 R82W probably damaging Het
Farp1 A T 14: 121,276,253 E820V probably benign Het
Fgd5 T A 6: 91,988,459 S400T possibly damaging Het
Flnc G A 6: 29,456,444 V2214I possibly damaging Het
Galnt4 C A 10: 99,109,113 N233K possibly damaging Het
Gbp5 A G 3: 142,503,080 Y128C probably damaging Het
Gm12394 A T 4: 42,793,546 H195Q possibly damaging Het
Gm4871 G A 5: 145,032,610 T33I probably benign Het
Gm5592 T C 7: 41,286,694 S207P probably benign Het
Gm9573 A T 17: 35,618,906 S1463T unknown Het
Gtf2ird1 A T 5: 134,417,131 C15* probably null Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ido2 T A 8: 24,547,226 I155F probably damaging Het
Ifi27l2b A T 12: 103,457,009 probably null Het
Il15ra C T 2: 11,723,593 T49I probably damaging Het
Itpr3 T A 17: 27,118,597 C2460* probably null Het
Kcnj11 T C 7: 46,099,755 N48S probably damaging Het
Lmo7 A C 14: 101,898,576 N695T possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myo5c A T 9: 75,279,345 D991V probably damaging Het
Nfkbid T A 7: 30,427,178 N396K probably damaging Het
Oas1c A G 5: 120,801,042 F361L probably benign Het
Olfr22-ps1 A T 11: 73,955,122 Y144F probably benign Het
Olfr433 A G 1: 174,042,084 I45V probably benign Het
Osbpl9 T C 4: 109,062,494 K606E probably benign Het
Pkp2 C A 16: 16,225,408 L111I probably benign Het
Pogz A G 3: 94,875,233 Y635C probably damaging Het
Prdx2 A G 8: 84,971,674 T165A probably benign Het
Ptcd3 T C 6: 71,885,557 I465V probably benign Het
Ptprd G A 4: 75,998,604 T770I probably damaging Het
Rapgef6 A G 11: 54,694,399 Y1541C probably damaging Het
Rilpl1 A T 5: 124,496,137 probably null Het
Rimbp3 T A 16: 17,212,704 Y1331N probably benign Het
Sav1 T C 12: 69,984,221 R176G probably damaging Het
Sirt5 A G 13: 43,383,147 H219R probably benign Het
Skint5 T G 4: 113,546,518 D1169A unknown Het
Slfn9 G T 11: 82,982,641 Q479K possibly damaging Het
Soga1 C T 2: 157,027,584 A1044T probably benign Het
Susd4 T C 1: 182,895,202 I483T possibly damaging Het
Tmem156 C T 5: 65,075,569 V217I possibly damaging Het
Tmem79 A G 3: 88,332,642 Y254H probably benign Het
Tmprss2 T A 16: 97,576,229 K223* probably null Het
Trav3-1 T C 14: 52,581,124 V85A probably damaging Het
Ttn T C 2: 76,885,756 probably null Het
Vmn2r22 T C 6: 123,637,600 I344V not run Het
Vps13c A T 9: 67,940,483 M2176L probably benign Het
Wdfy3 A T 5: 101,848,357 V3213D probably damaging Het
Zbtb21 G A 16: 97,951,454 T543M possibly damaging Het
Zc3hav1 A T 6: 38,332,756 V377D probably benign Het
Zswim3 T C 2: 164,819,779 C60R probably damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGGTACAACTCCATGGAG -3'
(R):5'- GCTTCAGAGTCATGAATAGGGGAC -3'

Sequencing Primer
(F):5'- TACAACTCCATGGAGGCGGTG -3'
(R):5'- GAGTCATGAATAGGGGACATTCTCTC -3'
Posted On2019-11-26