Incidental Mutation 'R7788:Cntn5'
ID599673
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7788 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9704929 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 622 (S622P)
Ref Sequence ENSEMBL: ENSMUSP00000124214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably benign
Transcript: ENSMUST00000074133
AA Change: S827P

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: S827P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160216
AA Change: S827P

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: S827P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162484
AA Change: S622P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: S622P

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179049
AA Change: S622P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: S622P

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,593 H473L possibly damaging Het
Adam7 A T 14: 68,512,645 V442E possibly damaging Het
Adgrv1 A T 13: 81,573,314 V715D probably damaging Het
Aldh1l1 A C 6: 90,569,912 D399A probably benign Het
Ankrd23 T C 1: 36,531,727 N274S probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Arpc4 A T 6: 113,385,604 M149L probably benign Het
Bdp1 T C 13: 100,055,251 T1407A possibly damaging Het
Calml3 A T 13: 3,804,121 I28N probably damaging Het
Cdhr3 A G 12: 33,060,320 S322P probably damaging Het
Col22a1 A G 15: 71,952,317 probably null Het
Csf2rb2 A T 15: 78,292,841 I143N probably benign Het
Cwh43 T C 5: 73,415,034 L205P probably damaging Het
Dennd5b T C 6: 149,068,566 T52A probably benign Het
Dhx40 A G 11: 86,775,676 I597T possibly damaging Het
Dnajc21 A G 15: 10,460,047 L268P probably damaging Het
Dzip1 A T 14: 118,883,393 D717E probably benign Het
Elmo3 A G 8: 105,308,244 N389D probably damaging Het
Evi2a T C 11: 79,527,942 E14G unknown Het
Fam149a T A 8: 45,381,517 R82W probably damaging Het
Farp1 A T 14: 121,276,253 E820V probably benign Het
Fgd5 T A 6: 91,988,459 S400T possibly damaging Het
Flnc G A 6: 29,456,444 V2214I possibly damaging Het
Galnt4 C A 10: 99,109,113 N233K possibly damaging Het
Gbp5 A G 3: 142,503,080 Y128C probably damaging Het
Gm12394 A T 4: 42,793,546 H195Q possibly damaging Het
Gm4871 G A 5: 145,032,610 T33I probably benign Het
Gm5592 T C 7: 41,286,694 S207P probably benign Het
Gm9573 A T 17: 35,618,906 S1463T unknown Het
Gtf2ird1 A T 5: 134,417,131 C15* probably null Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ido2 T A 8: 24,547,226 I155F probably damaging Het
Ifi27l2b A T 12: 103,457,009 probably null Het
Il15ra C T 2: 11,723,593 T49I probably damaging Het
Itpr3 T A 17: 27,118,597 C2460* probably null Het
Kcnj11 T C 7: 46,099,755 N48S probably damaging Het
Lmo7 A C 14: 101,898,576 N695T possibly damaging Het
Mmp15 C A 8: 95,368,148 H217N probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myo5c A T 9: 75,279,345 D991V probably damaging Het
Nfkbid T A 7: 30,427,178 N396K probably damaging Het
Oas1c A G 5: 120,801,042 F361L probably benign Het
Olfr22-ps1 A T 11: 73,955,122 Y144F probably benign Het
Olfr433 A G 1: 174,042,084 I45V probably benign Het
Osbpl9 T C 4: 109,062,494 K606E probably benign Het
Pkp2 C A 16: 16,225,408 L111I probably benign Het
Pogz A G 3: 94,875,233 Y635C probably damaging Het
Prdx2 A G 8: 84,971,674 T165A probably benign Het
Ptcd3 T C 6: 71,885,557 I465V probably benign Het
Ptprd G A 4: 75,998,604 T770I probably damaging Het
Rapgef6 A G 11: 54,694,399 Y1541C probably damaging Het
Rilpl1 A T 5: 124,496,137 probably null Het
Rimbp3 T A 16: 17,212,704 Y1331N probably benign Het
Sav1 T C 12: 69,984,221 R176G probably damaging Het
Sirt5 A G 13: 43,383,147 H219R probably benign Het
Skint5 T G 4: 113,546,518 D1169A unknown Het
Slfn9 G T 11: 82,982,641 Q479K possibly damaging Het
Soga1 C T 2: 157,027,584 A1044T probably benign Het
Susd4 T C 1: 182,895,202 I483T possibly damaging Het
Tmem156 C T 5: 65,075,569 V217I possibly damaging Het
Tmem79 A G 3: 88,332,642 Y254H probably benign Het
Tmprss2 T A 16: 97,576,229 K223* probably null Het
Trav3-1 T C 14: 52,581,124 V85A probably damaging Het
Ttn T C 2: 76,885,756 probably null Het
Vmn2r22 T C 6: 123,637,600 I344V not run Het
Vps13c A T 9: 67,940,483 M2176L probably benign Het
Wdfy3 A T 5: 101,848,357 V3213D probably damaging Het
Zbtb21 G A 16: 97,951,454 T543M possibly damaging Het
Zc3hav1 A T 6: 38,332,756 V377D probably benign Het
Zswim3 T C 2: 164,819,779 C60R probably damaging Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R7947:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R8117:Cntn5 UTSW 9 9673950 missense probably benign 0.33
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGCATTTTCTAAAACATGCAC -3'
(R):5'- CTCTGCAAAGCTAAGCATTAAGAG -3'

Sequencing Primer
(F):5'- TGCACACCATATCTCATTAAATGAC -3'
(R):5'- AGGATAGTGTTCCTCAGCCAG -3'
Posted On2019-11-26