Incidental Mutation 'R7788:Arid5b'
ID 599677
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 045844-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7788 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 67934417 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 495 (G495E)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218532
AA Change: G252E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219238
AA Change: G495E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 A T 14: 68,750,094 (GRCm39) V442E possibly damaging Het
Adgrv1 A T 13: 81,721,433 (GRCm39) V715D probably damaging Het
Aldh1l1 A C 6: 90,546,894 (GRCm39) D399A probably benign Het
Ankrd23 T C 1: 36,570,808 (GRCm39) N274S probably damaging Het
Aopep A T 13: 63,304,407 (GRCm39) H473L possibly damaging Het
Arpc4 A T 6: 113,362,565 (GRCm39) M149L probably benign Het
Bdp1 T C 13: 100,191,759 (GRCm39) T1407A possibly damaging Het
Calml3 A T 13: 3,854,121 (GRCm39) I28N probably damaging Het
Cdhr3 A G 12: 33,110,319 (GRCm39) S322P probably damaging Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Cntn5 A G 9: 9,704,934 (GRCm39) S622P probably benign Het
Col22a1 A G 15: 71,824,166 (GRCm39) probably null Het
Csf2rb2 A T 15: 78,177,041 (GRCm39) I143N probably benign Het
Cwh43 T C 5: 73,572,377 (GRCm39) L205P probably damaging Het
Dennd5b T C 6: 148,970,064 (GRCm39) T52A probably benign Het
Dhx40 A G 11: 86,666,502 (GRCm39) I597T possibly damaging Het
Dnajc21 A G 15: 10,460,133 (GRCm39) L268P probably damaging Het
Dzip1 A T 14: 119,120,805 (GRCm39) D717E probably benign Het
Elmo3 A G 8: 106,034,876 (GRCm39) N389D probably damaging Het
Evi2a T C 11: 79,418,768 (GRCm39) E14G unknown Het
Fam149a T A 8: 45,834,554 (GRCm39) R82W probably damaging Het
Farp1 A T 14: 121,513,665 (GRCm39) E820V probably benign Het
Fgd5 T A 6: 91,965,440 (GRCm39) S400T possibly damaging Het
Flnc G A 6: 29,456,443 (GRCm39) V2214I possibly damaging Het
Galnt4 C A 10: 98,944,975 (GRCm39) N233K possibly damaging Het
Gbp5 A G 3: 142,208,841 (GRCm39) Y128C probably damaging Het
Gm4871 G A 5: 144,969,420 (GRCm39) T33I probably benign Het
Gm5592 T C 7: 40,936,118 (GRCm39) S207P probably benign Het
Gtf2ird1 A T 5: 134,445,985 (GRCm39) C15* probably null Het
Ido2 T A 8: 25,037,242 (GRCm39) I155F probably damaging Het
Ifi27l2b A T 12: 103,423,268 (GRCm39) probably null Het
Il15ra C T 2: 11,728,404 (GRCm39) T49I probably damaging Het
Itpr3 T A 17: 27,337,571 (GRCm39) C2460* probably null Het
Kcnj11 T C 7: 45,749,179 (GRCm39) N48S probably damaging Het
Lmo7 A C 14: 102,136,012 (GRCm39) N695T possibly damaging Het
Mmp15 C A 8: 96,094,776 (GRCm39) H217N probably damaging Het
Mtcl2 C T 2: 156,869,504 (GRCm39) A1044T probably benign Het
Muc21 A T 17: 35,929,798 (GRCm39) S1463T unknown Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Myo5c A T 9: 75,186,627 (GRCm39) D991V probably damaging Het
Nfkbid T A 7: 30,126,603 (GRCm39) N396K probably damaging Het
Oas1c A G 5: 120,939,107 (GRCm39) F361L probably benign Het
Or10aa1 A G 1: 173,869,650 (GRCm39) I45V probably benign Het
Or1e1b-ps1 A T 11: 73,845,948 (GRCm39) Y144F probably benign Het
Osbpl9 T C 4: 108,919,691 (GRCm39) K606E probably benign Het
Pkp2 C A 16: 16,043,272 (GRCm39) L111I probably benign Het
Pogz A G 3: 94,782,544 (GRCm39) Y635C probably damaging Het
Prdx2 A G 8: 85,698,303 (GRCm39) T165A probably benign Het
Ptcd3 T C 6: 71,862,541 (GRCm39) I465V probably benign Het
Ptprd G A 4: 75,916,841 (GRCm39) T770I probably damaging Het
Rapgef6 A G 11: 54,585,225 (GRCm39) Y1541C probably damaging Het
Rilpl1 A T 5: 124,634,200 (GRCm39) probably null Het
Rimbp3 T A 16: 17,030,568 (GRCm39) Y1331N probably benign Het
Sav1 T C 12: 70,030,995 (GRCm39) R176G probably damaging Het
Sirt5 A G 13: 43,536,623 (GRCm39) H219R probably benign Het
Skint5 T G 4: 113,403,715 (GRCm39) D1169A unknown Het
Slfn9 G T 11: 82,873,467 (GRCm39) Q479K possibly damaging Het
Spata31f1e A T 4: 42,793,546 (GRCm39) H195Q possibly damaging Het
Susd4 T C 1: 182,722,767 (GRCm39) I483T possibly damaging Het
Tmem156 C T 5: 65,232,912 (GRCm39) V217I possibly damaging Het
Tmem79 A G 3: 88,239,949 (GRCm39) Y254H probably benign Het
Tmprss2 T A 16: 97,377,429 (GRCm39) K223* probably null Het
Trav3-1 T C 14: 52,818,581 (GRCm39) V85A probably damaging Het
Ttn T C 2: 76,716,100 (GRCm39) probably null Het
Vmn2r22 T C 6: 123,614,559 (GRCm39) I344V not run Het
Vps13c A T 9: 67,847,765 (GRCm39) M2176L probably benign Het
Wdfy3 A T 5: 101,996,223 (GRCm39) V3213D probably damaging Het
Zbtb21 G A 16: 97,752,654 (GRCm39) T543M possibly damaging Het
Zc3hav1 A T 6: 38,309,691 (GRCm39) V377D probably benign Het
Zswim3 T C 2: 164,661,699 (GRCm39) C60R probably damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6313:Arid5b UTSW 10 67,933,412 (GRCm39) missense possibly damaging 0.95
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7013:Arid5b UTSW 10 67,933,649 (GRCm39) missense probably damaging 1.00
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7324:Arid5b UTSW 10 67,964,752 (GRCm39) missense probably benign 0.44
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7432:Arid5b UTSW 10 67,954,096 (GRCm39) missense probably damaging 1.00
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7759:Arid5b UTSW 10 67,933,632 (GRCm39) missense probably damaging 1.00
R7779:Arid5b UTSW 10 67,932,606 (GRCm39) missense probably damaging 1.00
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGAGTCCATCTGGGTGC -3'
(R):5'- CTGGCTTCAAGGATAACTGCTG -3'

Sequencing Primer
(F):5'- CTGTTTGCCAGCCCCAG -3'
(R):5'- CAAGGATAACTGCTGTGTGTGATAC -3'
Posted On 2019-11-26