Mutagenetix > Incidental Mutations

Incidental Mutation 'R7788:Rapgef6'

599679

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7788 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54694399 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1541 (Y1541C)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000207429]

AlphaFold

Q5NCJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000101206
AA Change: Y1544C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: Y1544C

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102743
AA Change: Y1536C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: Y1536C

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136494

SMART Domains

Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

Domain	Start	End	E-Value	Type
low complexity region	47	55	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: Y1541C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5080

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	T	13: 63,156,593	H473L	possibly damaging	Het
Adam7	A	T	14: 68,512,645	V442E	possibly damaging	Het
Adgrv1	A	T	13: 81,573,314	V715D	probably damaging	Het
Aldh1l1	A	C	6: 90,569,912	D399A	probably benign	Het
Ankrd23	T	C	1: 36,531,727	N274S	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Arpc4	A	T	6: 113,385,604	M149L	probably benign	Het
Bdp1	T	C	13: 100,055,251	T1407A	possibly damaging	Het
Calml3	A	T	13: 3,804,121	I28N	probably damaging	Het
Cdhr3	A	G	12: 33,060,320	S322P	probably damaging	Het
Cntn5	A	G	9: 9,704,929	S622P	probably benign	Het
Col22a1	A	G	15: 71,952,317		probably null	Het
Csf2rb2	A	T	15: 78,292,841	I143N	probably benign	Het
Cwh43	T	C	5: 73,415,034	L205P	probably damaging	Het
Dennd5b	T	C	6: 149,068,566	T52A	probably benign	Het
Dhx40	A	G	11: 86,775,676	I597T	possibly damaging	Het
Dnajc21	A	G	15: 10,460,047	L268P	probably damaging	Het
Dzip1	A	T	14: 118,883,393	D717E	probably benign	Het
Elmo3	A	G	8: 105,308,244	N389D	probably damaging	Het
Evi2a	T	C	11: 79,527,942	E14G	unknown	Het
Fam149a	T	A	8: 45,381,517	R82W	probably damaging	Het
Farp1	A	T	14: 121,276,253	E820V	probably benign	Het
Fgd5	T	A	6: 91,988,459	S400T	possibly damaging	Het
Flnc	G	A	6: 29,456,444	V2214I	possibly damaging	Het
Galnt4	C	A	10: 99,109,113	N233K	possibly damaging	Het
Gbp5	A	G	3: 142,503,080	Y128C	probably damaging	Het
Gm12394	A	T	4: 42,793,546	H195Q	possibly damaging	Het
Gm4871	G	A	5: 145,032,610	T33I	probably benign	Het
Gm5592	T	C	7: 41,286,694	S207P	probably benign	Het
Gm9573	A	T	17: 35,618,906	S1463T	unknown	Het
Gtf2ird1	A	T	5: 134,417,131	C15*	probably null	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ido2	T	A	8: 24,547,226	I155F	probably damaging	Het
Ifi27l2b	A	T	12: 103,457,009		probably null	Het
Il15ra	C	T	2: 11,723,593	T49I	probably damaging	Het
Itpr3	T	A	17: 27,118,597	C2460*	probably null	Het
Kcnj11	T	C	7: 46,099,755	N48S	probably damaging	Het
Lmo7	A	C	14: 101,898,576	N695T	possibly damaging	Het
Mmp15	C	A	8: 95,368,148	H217N	probably damaging	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myo5c	A	T	9: 75,279,345	D991V	probably damaging	Het
Nfkbid	T	A	7: 30,427,178	N396K	probably damaging	Het
Oas1c	A	G	5: 120,801,042	F361L	probably benign	Het
Olfr22-ps1	A	T	11: 73,955,122	Y144F	probably benign	Het
Olfr433	A	G	1: 174,042,084	I45V	probably benign	Het
Osbpl9	T	C	4: 109,062,494	K606E	probably benign	Het
Pkp2	C	A	16: 16,225,408	L111I	probably benign	Het
Pogz	A	G	3: 94,875,233	Y635C	probably damaging	Het
Prdx2	A	G	8: 84,971,674	T165A	probably benign	Het
Ptcd3	T	C	6: 71,885,557	I465V	probably benign	Het
Ptprd	G	A	4: 75,998,604	T770I	probably damaging	Het
Rilpl1	A	T	5: 124,496,137		probably null	Het
Rimbp3	T	A	16: 17,212,704	Y1331N	probably benign	Het
Sav1	T	C	12: 69,984,221	R176G	probably damaging	Het
Sirt5	A	G	13: 43,383,147	H219R	probably benign	Het
Skint5	T	G	4: 113,546,518	D1169A	unknown	Het
Slfn9	G	T	11: 82,982,641	Q479K	possibly damaging	Het
Soga1	C	T	2: 157,027,584	A1044T	probably benign	Het
Susd4	T	C	1: 182,895,202	I483T	possibly damaging	Het
Tmem156	C	T	5: 65,075,569	V217I	possibly damaging	Het
Tmem79	A	G	3: 88,332,642	Y254H	probably benign	Het
Tmprss2	T	A	16: 97,576,229	K223*	probably null	Het
Trav3-1	T	C	14: 52,581,124	V85A	probably damaging	Het
Ttn	T	C	2: 76,885,756		probably null	Het
Vmn2r22	T	C	6: 123,637,600	I344V	not run	Het
Vps13c	A	T	9: 67,940,483	M2176L	probably benign	Het
Wdfy3	A	T	5: 101,848,357	V3213D	probably damaging	Het
Zbtb21	G	A	16: 97,951,454	T543M	possibly damaging	Het
Zc3hav1	A	T	6: 38,332,756	V377D	probably benign	Het
Zswim3	T	C	2: 164,819,779	C60R	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTCTGGCTTCATGTAGCTG -3'
(R):5'- GCTTCGCTATCTGCATCAGC -3'

Sequencing Primer
(F):5'- CTCTGGCTTCATGTAGCTGTCTATG -3'
(R):5'- CCACATCTGCTAGCTTGGGATG -3'

Posted On

2019-11-26