Incidental Mutation 'R7788:2010111I01Rik'
ID599688
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7788 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63156593 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 473 (H473L)
Ref Sequence ENSEMBL: ENSMUSP00000089148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560] [ENSMUST00000222907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021911
AA Change: H472L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: H472L

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091560
AA Change: H473L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: H473L

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Predicted Effect probably benign
Transcript: ENSMUST00000222907
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 A T 14: 68,512,645 V442E possibly damaging Het
Adgrv1 A T 13: 81,573,314 V715D probably damaging Het
Aldh1l1 A C 6: 90,569,912 D399A probably benign Het
Ankrd23 T C 1: 36,531,727 N274S probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Arpc4 A T 6: 113,385,604 M149L probably benign Het
Bdp1 T C 13: 100,055,251 T1407A possibly damaging Het
Calml3 A T 13: 3,804,121 I28N probably damaging Het
Cdhr3 A G 12: 33,060,320 S322P probably damaging Het
Cntn5 A G 9: 9,704,929 S622P probably benign Het
Col22a1 A G 15: 71,952,317 probably null Het
Csf2rb2 A T 15: 78,292,841 I143N probably benign Het
Cwh43 T C 5: 73,415,034 L205P probably damaging Het
Dennd5b T C 6: 149,068,566 T52A probably benign Het
Dhx40 A G 11: 86,775,676 I597T possibly damaging Het
Dnajc21 A G 15: 10,460,047 L268P probably damaging Het
Dzip1 A T 14: 118,883,393 D717E probably benign Het
Elmo3 A G 8: 105,308,244 N389D probably damaging Het
Evi2a T C 11: 79,527,942 E14G unknown Het
Fam149a T A 8: 45,381,517 R82W probably damaging Het
Farp1 A T 14: 121,276,253 E820V probably benign Het
Fgd5 T A 6: 91,988,459 S400T possibly damaging Het
Flnc G A 6: 29,456,444 V2214I possibly damaging Het
Galnt4 C A 10: 99,109,113 N233K possibly damaging Het
Gbp5 A G 3: 142,503,080 Y128C probably damaging Het
Gm12394 A T 4: 42,793,546 H195Q possibly damaging Het
Gm4871 G A 5: 145,032,610 T33I probably benign Het
Gm5592 T C 7: 41,286,694 S207P probably benign Het
Gm9573 A T 17: 35,618,906 S1463T unknown Het
Gtf2ird1 A T 5: 134,417,131 C15* probably null Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ido2 T A 8: 24,547,226 I155F probably damaging Het
Ifi27l2b A T 12: 103,457,009 probably null Het
Il15ra C T 2: 11,723,593 T49I probably damaging Het
Itpr3 T A 17: 27,118,597 C2460* probably null Het
Kcnj11 T C 7: 46,099,755 N48S probably damaging Het
Lmo7 A C 14: 101,898,576 N695T possibly damaging Het
Mmp15 C A 8: 95,368,148 H217N probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myo5c A T 9: 75,279,345 D991V probably damaging Het
Nfkbid T A 7: 30,427,178 N396K probably damaging Het
Oas1c A G 5: 120,801,042 F361L probably benign Het
Olfr22-ps1 A T 11: 73,955,122 Y144F probably benign Het
Olfr433 A G 1: 174,042,084 I45V probably benign Het
Osbpl9 T C 4: 109,062,494 K606E probably benign Het
Pkp2 C A 16: 16,225,408 L111I probably benign Het
Pogz A G 3: 94,875,233 Y635C probably damaging Het
Prdx2 A G 8: 84,971,674 T165A probably benign Het
Ptcd3 T C 6: 71,885,557 I465V probably benign Het
Ptprd G A 4: 75,998,604 T770I probably damaging Het
Rapgef6 A G 11: 54,694,399 Y1541C probably damaging Het
Rilpl1 A T 5: 124,496,137 probably null Het
Rimbp3 T A 16: 17,212,704 Y1331N probably benign Het
Sav1 T C 12: 69,984,221 R176G probably damaging Het
Sirt5 A G 13: 43,383,147 H219R probably benign Het
Skint5 T G 4: 113,546,518 D1169A unknown Het
Slfn9 G T 11: 82,982,641 Q479K possibly damaging Het
Soga1 C T 2: 157,027,584 A1044T probably benign Het
Susd4 T C 1: 182,895,202 I483T possibly damaging Het
Tmem156 C T 5: 65,075,569 V217I possibly damaging Het
Tmem79 A G 3: 88,332,642 Y254H probably benign Het
Tmprss2 T A 16: 97,576,229 K223* probably null Het
Trav3-1 T C 14: 52,581,124 V85A probably damaging Het
Ttn T C 2: 76,885,756 probably null Het
Vmn2r22 T C 6: 123,637,600 I344V not run Het
Vps13c A T 9: 67,940,483 M2176L probably benign Het
Wdfy3 A T 5: 101,848,357 V3213D probably damaging Het
Zbtb21 G A 16: 97,951,454 T543M possibly damaging Het
Zc3hav1 A T 6: 38,332,756 V377D probably benign Het
Zswim3 T C 2: 164,819,779 C60R probably damaging Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
PIT4378001:2010111I01Rik UTSW 13 63015207 missense probably damaging 1.00
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 splice site probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
R7038:2010111I01Rik UTSW 13 63190525 missense possibly damaging 0.54
R7493:2010111I01Rik UTSW 13 63015531 missense probably benign 0.01
R7970:2010111I01Rik UTSW 13 63033160 missense probably benign 0.11
R7988:2010111I01Rik UTSW 13 63061140 missense probably benign 0.00
R8041:2010111I01Rik UTSW 13 63033107 missense probably damaging 1.00
R8052:2010111I01Rik UTSW 13 63068251 missense probably damaging 1.00
R8053:2010111I01Rik UTSW 13 63190531 nonsense probably null
Z1177:2010111I01Rik UTSW 13 63170990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGATCCGGCATGCACAC -3'
(R):5'- GCAAACATAGTGCTTAGTACACACAG -3'

Sequencing Primer
(F):5'- CACAGTAATAACAGACTCTGTGGGC -3'
(R):5'- GTGCTTAGTACACACAGCATATAATC -3'
Posted On2019-11-26