Mutagenetix > Incidental Mutation

Incidental Mutation 'R7788:Bdp1'

599690

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7788 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100055251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1407 (T1407A)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

probably benign
Transcript: ENSMUST00000038104
AA Change: T1407A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: T1407A

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109379
AA Change: T1407A

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: T1407A

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	T	13: 63,156,593	H473L	possibly damaging	Het
Adam7	A	T	14: 68,512,645	V442E	possibly damaging	Het
Adgrv1	A	T	13: 81,573,314	V715D	probably damaging	Het
Aldh1l1	A	C	6: 90,569,912	D399A	probably benign	Het
Ankrd23	T	C	1: 36,531,727	N274S	probably damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Arpc4	A	T	6: 113,385,604	M149L	probably benign	Het
Calml3	A	T	13: 3,804,121	I28N	probably damaging	Het
Cdhr3	A	G	12: 33,060,320	S322P	probably damaging	Het
Cntn5	A	G	9: 9,704,929	S622P	probably benign	Het
Col22a1	A	G	15: 71,952,317		probably null	Het
Csf2rb2	A	T	15: 78,292,841	I143N	probably benign	Het
Cwh43	T	C	5: 73,415,034	L205P	probably damaging	Het
Dennd5b	T	C	6: 149,068,566	T52A	probably benign	Het
Dhx40	A	G	11: 86,775,676	I597T	possibly damaging	Het
Dnajc21	A	G	15: 10,460,047	L268P	probably damaging	Het
Dzip1	A	T	14: 118,883,393	D717E	probably benign	Het
Elmo3	A	G	8: 105,308,244	N389D	probably damaging	Het
Evi2a	T	C	11: 79,527,942	E14G	unknown	Het
Fam149a	T	A	8: 45,381,517	R82W	probably damaging	Het
Farp1	A	T	14: 121,276,253	E820V	probably benign	Het
Fgd5	T	A	6: 91,988,459	S400T	possibly damaging	Het
Flnc	G	A	6: 29,456,444	V2214I	possibly damaging	Het
Galnt4	C	A	10: 99,109,113	N233K	possibly damaging	Het
Gbp5	A	G	3: 142,503,080	Y128C	probably damaging	Het
Gm12394	A	T	4: 42,793,546	H195Q	possibly damaging	Het
Gm4871	G	A	5: 145,032,610	T33I	probably benign	Het
Gm5592	T	C	7: 41,286,694	S207P	probably benign	Het
Gm9573	A	T	17: 35,618,906	S1463T	unknown	Het
Gtf2ird1	A	T	5: 134,417,131	C15*	probably null	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ido2	T	A	8: 24,547,226	I155F	probably damaging	Het
Ifi27l2b	A	T	12: 103,457,009		probably null	Het
Il15ra	C	T	2: 11,723,593	T49I	probably damaging	Het
Itpr3	T	A	17: 27,118,597	C2460*	probably null	Het
Kcnj11	T	C	7: 46,099,755	N48S	probably damaging	Het
Lmo7	A	C	14: 101,898,576	N695T	possibly damaging	Het
Mmp15	C	A	8: 95,368,148	H217N	probably damaging	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myo5c	A	T	9: 75,279,345	D991V	probably damaging	Het
Nfkbid	T	A	7: 30,427,178	N396K	probably damaging	Het
Oas1c	A	G	5: 120,801,042	F361L	probably benign	Het
Olfr22-ps1	A	T	11: 73,955,122	Y144F	probably benign	Het
Olfr433	A	G	1: 174,042,084	I45V	probably benign	Het
Osbpl9	T	C	4: 109,062,494	K606E	probably benign	Het
Pkp2	C	A	16: 16,225,408	L111I	probably benign	Het
Pogz	A	G	3: 94,875,233	Y635C	probably damaging	Het
Prdx2	A	G	8: 84,971,674	T165A	probably benign	Het
Ptcd3	T	C	6: 71,885,557	I465V	probably benign	Het
Ptprd	G	A	4: 75,998,604	T770I	probably damaging	Het
Rapgef6	A	G	11: 54,694,399	Y1541C	probably damaging	Het
Rilpl1	A	T	5: 124,496,137		probably null	Het
Rimbp3	T	A	16: 17,212,704	Y1331N	probably benign	Het
Sav1	T	C	12: 69,984,221	R176G	probably damaging	Het
Sirt5	A	G	13: 43,383,147	H219R	probably benign	Het
Skint5	T	G	4: 113,546,518	D1169A	unknown	Het
Slfn9	G	T	11: 82,982,641	Q479K	possibly damaging	Het
Soga1	C	T	2: 157,027,584	A1044T	probably benign	Het
Susd4	T	C	1: 182,895,202	I483T	possibly damaging	Het
Tmem156	C	T	5: 65,075,569	V217I	possibly damaging	Het
Tmem79	A	G	3: 88,332,642	Y254H	probably benign	Het
Tmprss2	T	A	16: 97,576,229	K223*	probably null	Het
Trav3-1	T	C	14: 52,581,124	V85A	probably damaging	Het
Ttn	T	C	2: 76,885,756		probably null	Het
Vmn2r22	T	C	6: 123,637,600	I344V	not run	Het
Vps13c	A	T	9: 67,940,483	M2176L	probably benign	Het
Wdfy3	A	T	5: 101,848,357	V3213D	probably damaging	Het
Zbtb21	G	A	16: 97,951,454	T543M	possibly damaging	Het
Zc3hav1	A	T	6: 38,332,756	V377D	probably benign	Het
Zswim3	T	C	2: 164,819,779	C60R	probably damaging	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGATCAATTCTCTCACCAC -3'
(R):5'- TGAATGAGCTTCCTCTGCCC -3'

Sequencing Primer
(F):5'- CCACAGTCAGGCATGTTCTAG -3'
(R):5'- TAATCTAGAACTGTACACTAGCCG -3'

Posted On

2019-11-26