Incidental Mutation 'R7788:Adam7'
ID599692
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7788 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68512645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 442 (V442E)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022640
AA Change: V442E

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: V442E

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,156,593 H473L possibly damaging Het
Adgrv1 A T 13: 81,573,314 V715D probably damaging Het
Aldh1l1 A C 6: 90,569,912 D399A probably benign Het
Ankrd23 T C 1: 36,531,727 N274S probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Arpc4 A T 6: 113,385,604 M149L probably benign Het
Bdp1 T C 13: 100,055,251 T1407A possibly damaging Het
Calml3 A T 13: 3,804,121 I28N probably damaging Het
Cdhr3 A G 12: 33,060,320 S322P probably damaging Het
Cntn5 A G 9: 9,704,929 S622P probably benign Het
Col22a1 A G 15: 71,952,317 probably null Het
Csf2rb2 A T 15: 78,292,841 I143N probably benign Het
Cwh43 T C 5: 73,415,034 L205P probably damaging Het
Dennd5b T C 6: 149,068,566 T52A probably benign Het
Dhx40 A G 11: 86,775,676 I597T possibly damaging Het
Dnajc21 A G 15: 10,460,047 L268P probably damaging Het
Dzip1 A T 14: 118,883,393 D717E probably benign Het
Elmo3 A G 8: 105,308,244 N389D probably damaging Het
Evi2a T C 11: 79,527,942 E14G unknown Het
Fam149a T A 8: 45,381,517 R82W probably damaging Het
Farp1 A T 14: 121,276,253 E820V probably benign Het
Fgd5 T A 6: 91,988,459 S400T possibly damaging Het
Flnc G A 6: 29,456,444 V2214I possibly damaging Het
Galnt4 C A 10: 99,109,113 N233K possibly damaging Het
Gbp5 A G 3: 142,503,080 Y128C probably damaging Het
Gm12394 A T 4: 42,793,546 H195Q possibly damaging Het
Gm4871 G A 5: 145,032,610 T33I probably benign Het
Gm5592 T C 7: 41,286,694 S207P probably benign Het
Gm9573 A T 17: 35,618,906 S1463T unknown Het
Gtf2ird1 A T 5: 134,417,131 C15* probably null Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ido2 T A 8: 24,547,226 I155F probably damaging Het
Ifi27l2b A T 12: 103,457,009 probably null Het
Il15ra C T 2: 11,723,593 T49I probably damaging Het
Itpr3 T A 17: 27,118,597 C2460* probably null Het
Kcnj11 T C 7: 46,099,755 N48S probably damaging Het
Lmo7 A C 14: 101,898,576 N695T possibly damaging Het
Mmp15 C A 8: 95,368,148 H217N probably damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myo5c A T 9: 75,279,345 D991V probably damaging Het
Nfkbid T A 7: 30,427,178 N396K probably damaging Het
Oas1c A G 5: 120,801,042 F361L probably benign Het
Olfr22-ps1 A T 11: 73,955,122 Y144F probably benign Het
Olfr433 A G 1: 174,042,084 I45V probably benign Het
Osbpl9 T C 4: 109,062,494 K606E probably benign Het
Pkp2 C A 16: 16,225,408 L111I probably benign Het
Pogz A G 3: 94,875,233 Y635C probably damaging Het
Prdx2 A G 8: 84,971,674 T165A probably benign Het
Ptcd3 T C 6: 71,885,557 I465V probably benign Het
Ptprd G A 4: 75,998,604 T770I probably damaging Het
Rapgef6 A G 11: 54,694,399 Y1541C probably damaging Het
Rilpl1 A T 5: 124,496,137 probably null Het
Rimbp3 T A 16: 17,212,704 Y1331N probably benign Het
Sav1 T C 12: 69,984,221 R176G probably damaging Het
Sirt5 A G 13: 43,383,147 H219R probably benign Het
Skint5 T G 4: 113,546,518 D1169A unknown Het
Slfn9 G T 11: 82,982,641 Q479K possibly damaging Het
Soga1 C T 2: 157,027,584 A1044T probably benign Het
Susd4 T C 1: 182,895,202 I483T possibly damaging Het
Tmem156 C T 5: 65,075,569 V217I possibly damaging Het
Tmem79 A G 3: 88,332,642 Y254H probably benign Het
Tmprss2 T A 16: 97,576,229 K223* probably null Het
Trav3-1 T C 14: 52,581,124 V85A probably damaging Het
Ttn T C 2: 76,885,756 probably null Het
Vmn2r22 T C 6: 123,637,600 I344V not run Het
Vps13c A T 9: 67,940,483 M2176L probably benign Het
Wdfy3 A T 5: 101,848,357 V3213D probably damaging Het
Zbtb21 G A 16: 97,951,454 T543M possibly damaging Het
Zc3hav1 A T 6: 38,332,756 V377D probably benign Het
Zswim3 T C 2: 164,819,779 C60R probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2353:Adam7 UTSW 14 68505088 missense probably benign 0.01
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 splice site probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R8135:Adam7 UTSW 14 68516573 missense probably damaging 1.00
R8281:Adam7 UTSW 14 68507885 missense possibly damaging 0.65
R8507:Adam7 UTSW 14 68526324 missense probably damaging 1.00
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTCCATATGAAAGCAGCACTTGG -3'
(R):5'- TTACATGGAGCTCTTGAAGGAGG -3'

Sequencing Primer
(F):5'- TGAAAGCAGCACTTGGTTCAAAC -3'
(R):5'- GCTCTTGAAGGAGGAGCAC -3'
Posted On2019-11-26