Incidental Mutation 'R7789:Mgat4a'
ID 599705
Institutional Source Beutler Lab
Gene Symbol Mgat4a
Ensembl Gene ENSMUSG00000026110
Gene Name mannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms 9530018I07Rik, GnT-IVa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37439340-37541016 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37490279 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 173 (I173K)
Ref Sequence ENSEMBL: ENSMUSP00000038894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000143636] [ENSMUST00000148047] [ENSMUST00000149791] [ENSMUST00000151952] [ENSMUST00000154819]
AlphaFold Q812G0
Predicted Effect probably damaging
Transcript: ENSMUST00000042161
AA Change: I173K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110
AA Change: I173K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 75 380 5.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143636
AA Change: I35K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122909
Gene: ENSMUSG00000026110
AA Change: I35K

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 242 1.2e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148047
AA Change: I35K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118692
Gene: ENSMUSG00000026110
AA Change: I35K

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 112 5e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149791
AA Change: I35K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115778
Gene: ENSMUSG00000026110
AA Change: I35K

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 62 2.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151952
AA Change: I173K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110
AA Change: I173K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 86 380 7.5e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154819
AA Change: I164K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110
AA Change: I164K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 71 371 4.8e-137 PFAM
Meta Mutation Damage Score 0.5223 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Mgat4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mgat4a APN 1 37449123 nonsense probably null
IGL01720:Mgat4a APN 1 37444898 missense probably damaging 1.00
IGL02103:Mgat4a APN 1 37462926 missense possibly damaging 0.94
IGL03177:Mgat4a APN 1 37444887 missense probably damaging 1.00
R0090:Mgat4a UTSW 1 37490333 missense probably damaging 1.00
R0269:Mgat4a UTSW 1 37490307 missense possibly damaging 0.89
R0635:Mgat4a UTSW 1 37452294 missense probably benign 0.11
R1114:Mgat4a UTSW 1 37464406 splice site probably benign
R1120:Mgat4a UTSW 1 37452581 missense probably damaging 1.00
R1466:Mgat4a UTSW 1 37464406 splice site probably benign
R1940:Mgat4a UTSW 1 37536037 critical splice donor site probably null
R2257:Mgat4a UTSW 1 37490313 missense probably benign 0.13
R2293:Mgat4a UTSW 1 37452592 missense probably damaging 0.99
R2370:Mgat4a UTSW 1 37464533 missense probably damaging 0.96
R2392:Mgat4a UTSW 1 37498704 missense probably damaging 1.00
R3952:Mgat4a UTSW 1 37450414 splice site probably benign
R4563:Mgat4a UTSW 1 37466579 missense probably damaging 1.00
R5424:Mgat4a UTSW 1 37466555 missense probably benign 0.01
R5494:Mgat4a UTSW 1 37454817 missense probably damaging 1.00
R5505:Mgat4a UTSW 1 37495954 missense probably benign 0.04
R5938:Mgat4a UTSW 1 37452263 missense probably damaging 0.99
R6237:Mgat4a UTSW 1 37456592 missense probably damaging 1.00
R6589:Mgat4a UTSW 1 37444895 missense probably damaging 0.99
R6817:Mgat4a UTSW 1 37449123 nonsense probably null
R6825:Mgat4a UTSW 1 37464434 nonsense probably null
R7402:Mgat4a UTSW 1 37454784 missense probably damaging 1.00
R7507:Mgat4a UTSW 1 37452527 missense probably damaging 1.00
R8835:Mgat4a UTSW 1 37452291 missense possibly damaging 0.91
R9400:Mgat4a UTSW 1 37462944 missense probably damaging 1.00
R9424:Mgat4a UTSW 1 37490355 missense probably damaging 1.00
X0063:Mgat4a UTSW 1 37462890 critical splice donor site probably null
Z1177:Mgat4a UTSW 1 37490372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGAGTCTCTAGAGCATC -3'
(R):5'- ACCCCTATAAAGTTGTCTGTATTCG -3'

Sequencing Primer
(F):5'- GAGTCTCTAGAGCATCGGTTCTCAAC -3'
(R):5'- GGAATTCCTACTGTGAAGAGA -3'
Posted On 2019-11-26