Incidental Mutation 'R7789:Cyp4a14'
ID599719
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115486200-115496142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 115494910 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 102 (V102L)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: V102L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: V102L

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115489952 splice site probably benign
IGL01539:Cyp4a14 APN 4 115487177 missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115494937 nonsense probably null
IGL02309:Cyp4a14 APN 4 115491632 missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115495027 splice site probably benign
IGL03302:Cyp4a14 APN 4 115491378 missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115489996 missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115492170 missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115491134 missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115495936 missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115495929 missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115493609 missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115491410 missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115496100 nonsense probably null
R6269:Cyp4a14 UTSW 4 115491131 missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115487244 missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115496083 missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115489959 splice site probably null
R6563:Cyp4a14 UTSW 4 115492086 missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115491194 missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115491081 missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115491161 missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115493710 splice site probably null
R7544:Cyp4a14 UTSW 4 115491086 missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115493609 missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115489959 splice site probably null
R7753:Cyp4a14 UTSW 4 115493664 missense probably damaging 1.00
R8064:Cyp4a14 UTSW 4 115494958 missense probably benign
Z1176:Cyp4a14 UTSW 4 115490017 missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115491453 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCATATGTTGGTCTCTGGACAGAAAG -3'
(R):5'- TTGAACATGCCAGAGTTATGCCC -3'

Sequencing Primer
(F):5'- TTGGTCTCTGGACAGAAAGAATGG -3'
(R):5'- ATGCCAGAGTTATGCCCCTGTG -3'
Posted On2019-11-26