Incidental Mutation 'R7789:Vmn2r17'
ID 599724
Institutional Source Beutler Lab
Gene Symbol Vmn2r17
Ensembl Gene ENSMUSG00000091879
Gene Name vomeronasal 2, receptor 17
Synonyms EG384221
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109420013-109453387 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109452965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 710 (C710S)
Ref Sequence ENSEMBL: ENSMUSP00000131450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171841]
AlphaFold E9PYF5
Predicted Effect possibly damaging
Transcript: ENSMUST00000171841
AA Change: C710S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131450
Gene: ENSMUSG00000091879
AA Change: C710S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 465 7e-26 PFAM
Pfam:NCD3G 508 562 3.5e-18 PFAM
Pfam:7tm_3 593 830 4.8e-55 PFAM
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Vmn2r17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Vmn2r17 APN 5 109427992 missense probably benign 0.15
IGL01457:Vmn2r17 APN 5 109453032 missense probably benign 0.00
IGL01527:Vmn2r17 APN 5 109453140 missense probably damaging 1.00
IGL01693:Vmn2r17 APN 5 109452518 missense probably damaging 1.00
IGL01738:Vmn2r17 APN 5 109429498 missense probably damaging 1.00
IGL01767:Vmn2r17 APN 5 109420037 missense probably benign 0.01
IGL01932:Vmn2r17 APN 5 109427050 missense probably benign 0.00
IGL01970:Vmn2r17 APN 5 109427947 missense probably damaging 0.97
IGL02009:Vmn2r17 APN 5 109452848 missense possibly damaging 0.67
IGL02365:Vmn2r17 APN 5 109453309 missense probably damaging 1.00
IGL02385:Vmn2r17 APN 5 109434381 missense probably damaging 1.00
IGL02457:Vmn2r17 APN 5 109453146 missense probably damaging 1.00
IGL02646:Vmn2r17 APN 5 109453080 missense probably damaging 1.00
IGL02741:Vmn2r17 APN 5 109420211 missense probably benign
IGL03213:Vmn2r17 APN 5 109434390 critical splice donor site probably null
IGL03216:Vmn2r17 APN 5 109452890 missense probably damaging 1.00
IGL03342:Vmn2r17 APN 5 109427916 missense probably damaging 1.00
IGL03408:Vmn2r17 APN 5 109429372 splice site probably benign
R0349:Vmn2r17 UTSW 5 109428336 missense probably damaging 1.00
R0418:Vmn2r17 UTSW 5 109452881 missense probably damaging 1.00
R0800:Vmn2r17 UTSW 5 109427326 splice site probably benign
R0836:Vmn2r17 UTSW 5 109427956 missense possibly damaging 0.89
R1715:Vmn2r17 UTSW 5 109428244 missense probably benign 0.00
R1738:Vmn2r17 UTSW 5 109428511 missense probably benign 0.10
R1801:Vmn2r17 UTSW 5 109428478 missense probably damaging 1.00
R2054:Vmn2r17 UTSW 5 109452486 missense probably damaging 0.98
R2060:Vmn2r17 UTSW 5 109427209 missense probably benign 0.00
R2192:Vmn2r17 UTSW 5 109434278 missense possibly damaging 0.81
R2315:Vmn2r17 UTSW 5 109428031 missense probably damaging 1.00
R2374:Vmn2r17 UTSW 5 109427238 missense probably benign
R3612:Vmn2r17 UTSW 5 109429597 missense probably benign 0.00
R3832:Vmn2r17 UTSW 5 109428396 missense probably damaging 1.00
R4273:Vmn2r17 UTSW 5 109452966 missense probably benign 0.44
R4494:Vmn2r17 UTSW 5 109428469 missense probably damaging 1.00
R4597:Vmn2r17 UTSW 5 109429562 missense probably benign 0.01
R4675:Vmn2r17 UTSW 5 109427183 missense probably benign 0.00
R4701:Vmn2r17 UTSW 5 109427983 missense probably damaging 0.99
R4754:Vmn2r17 UTSW 5 109452849 missense probably damaging 0.99
R4841:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4842:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4865:Vmn2r17 UTSW 5 109427119 missense probably damaging 1.00
R4902:Vmn2r17 UTSW 5 109453354 missense probably benign 0.14
R4989:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R5101:Vmn2r17 UTSW 5 109428351 missense probably damaging 0.99
R5109:Vmn2r17 UTSW 5 109429476 missense probably benign 0.06
R5123:Vmn2r17 UTSW 5 109427908 missense possibly damaging 0.90
R5474:Vmn2r17 UTSW 5 109434284 missense probably damaging 1.00
R5485:Vmn2r17 UTSW 5 109420106 missense probably benign 0.06
R5611:Vmn2r17 UTSW 5 109428164 missense probably damaging 0.97
R5652:Vmn2r17 UTSW 5 109429564 missense probably benign 0.10
R5717:Vmn2r17 UTSW 5 109427274 missense possibly damaging 0.94
R5735:Vmn2r17 UTSW 5 109452850 missense possibly damaging 0.67
R5766:Vmn2r17 UTSW 5 109427273 missense possibly damaging 0.46
R6645:Vmn2r17 UTSW 5 109428381 missense probably damaging 1.00
R6786:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R6821:Vmn2r17 UTSW 5 109429465 missense probably damaging 1.00
R6979:Vmn2r17 UTSW 5 109428399 missense possibly damaging 0.46
R6984:Vmn2r17 UTSW 5 109452667 missense probably benign 0.10
R7269:Vmn2r17 UTSW 5 109428471 missense possibly damaging 0.88
R7509:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R7736:Vmn2r17 UTSW 5 109452891 missense probably benign 0.05
R7814:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R7847:Vmn2r17 UTSW 5 109420197 missense probably damaging 1.00
R7863:Vmn2r17 UTSW 5 109420169 missense probably benign
R7893:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
R8234:Vmn2r17 UTSW 5 109453369 missense probably benign 0.01
R8382:Vmn2r17 UTSW 5 109428521 missense probably benign 0.01
R8435:Vmn2r17 UTSW 5 109428306 missense probably benign 0.01
R8465:Vmn2r17 UTSW 5 109452825 missense probably damaging 0.99
R8555:Vmn2r17 UTSW 5 109452944 missense probably damaging 0.99
R8900:Vmn2r17 UTSW 5 109427997 missense probably benign 0.25
R9293:Vmn2r17 UTSW 5 109452846 missense probably damaging 1.00
R9308:Vmn2r17 UTSW 5 109452639 missense probably damaging 0.98
R9378:Vmn2r17 UTSW 5 109427866 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATCCTACAGCAGACCACATTTG -3'
(R):5'- TGCTGAACGTTAGGAACTTGGC -3'

Sequencing Primer
(F):5'- CATTTGGAGTATTTTTCACAGTAGCC -3'
(R):5'- GCTTCATTGAATCTGTCAGGAAG -3'
Posted On 2019-11-26