Incidental Mutation 'R7789:Plbd2'
ID599725
Institutional Source Beutler Lab
Gene Symbol Plbd2
Ensembl Gene ENSMUSG00000029598
Gene Namephospholipase B domain containing 2
Synonyms66.3 kDa, p76, 1300012G16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location120483282-120503625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120485754 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 568 (S568G)
Ref Sequence ENSEMBL: ENSMUSP00000031597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031597] [ENSMUST00000066540] [ENSMUST00000201684]
PDB Structure
Crystal structure of the lysosomal 66.3 kDa protein from mouse solved by S-SAD [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein at 1.8 Angstroem [X-RAY DIFFRACTION]
Two chain form of the 66.3 kDa protein from mouse lacking the linker peptide [X-RAY DIFFRACTION]
One chain form of the 66.3 kDa protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031597
AA Change: S568G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031597
Gene: ENSMUSG00000029598
AA Change: S568G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Phospholip_B 62 591 2.9e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066540
SMART Domains Protein: ENSMUSP00000064849
Gene: ENSMUSG00000029597

DomainStartEndE-ValueType
Pfam:PALP 5 304 1.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201684
SMART Domains Protein: ENSMUSP00000143838
Gene: ENSMUSG00000029597

DomainStartEndE-ValueType
Pfam:PALP 5 304 1.5e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Plbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Plbd2 APN 5 120485810 missense possibly damaging 0.57
IGL01635:Plbd2 APN 5 120499049 missense probably damaging 1.00
IGL02017:Plbd2 APN 5 120488558 missense probably damaging 1.00
IGL02040:Plbd2 APN 5 120487442 missense probably damaging 1.00
IGL03094:Plbd2 APN 5 120486780 missense probably damaging 1.00
IGL03124:Plbd2 APN 5 120493077 missense possibly damaging 0.68
R0077:Plbd2 UTSW 5 120486039 critical splice donor site probably null
R0087:Plbd2 UTSW 5 120494485 nonsense probably null
R0294:Plbd2 UTSW 5 120487449 unclassified probably null
R1682:Plbd2 UTSW 5 120485784 missense probably damaging 0.97
R1818:Plbd2 UTSW 5 120487509 splice site probably null
R3796:Plbd2 UTSW 5 120492868 missense probably damaging 1.00
R4935:Plbd2 UTSW 5 120486721 missense possibly damaging 0.95
R5082:Plbd2 UTSW 5 120491184 nonsense probably null
R5420:Plbd2 UTSW 5 120494482 missense probably damaging 0.98
R5441:Plbd2 UTSW 5 120499082 missense probably benign
R5582:Plbd2 UTSW 5 120493106 missense probably benign 0.00
R5643:Plbd2 UTSW 5 120493166 splice site probably null
R6831:Plbd2 UTSW 5 120493066 missense probably benign 0.03
R6859:Plbd2 UTSW 5 120503342 missense probably benign
R7343:Plbd2 UTSW 5 120493149 missense probably damaging 1.00
R7436:Plbd2 UTSW 5 120486796 missense probably damaging 1.00
R7779:Plbd2 UTSW 5 120487678 missense probably damaging 1.00
Z1177:Plbd2 UTSW 5 120503599 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTAGTGAAGACAGAAGCCCG -3'
(R):5'- TAAGCCAGTTGTCACATGCCC -3'

Sequencing Primer
(F):5'- CAGAAGCCCGAGGGGTG -3'
(R):5'- ATATCACTTTGGGGTCAGCTTCAG -3'
Posted On2019-11-26