Incidental Mutation 'R7789:Mphosph9'
ID599726
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene NameM-phase phosphoprotein 9
SynonymsMPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7789 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124250959-124327972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 124315587 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 221 (E221Q)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000031344
AA Change: E191Q

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: E191Q

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130502
SMART Domains Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

DomainStartEndE-ValueType
low complexity region 47 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141203
Predicted Effect probably benign
Transcript: ENSMUST00000147737
Predicted Effect probably damaging
Transcript: ENSMUST00000184951
AA Change: E221Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: E221Q

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124262021 missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124283624 splice site probably benign
IGL01784:Mphosph9 APN 5 124265310 splice site probably benign
IGL01958:Mphosph9 APN 5 124324990 utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124258950 missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124265425 missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124260087 missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124297571 nonsense probably null
IGL02640:Mphosph9 APN 5 124315500 missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124259989 missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124315628 missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124263011 missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124298790 missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124298829 missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124315568 missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124306970 nonsense probably null
R0811:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124262037 nonsense probably null
R1175:Mphosph9 UTSW 5 124315676 missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124283745 splice site probably null
R1442:Mphosph9 UTSW 5 124265398 missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124267141 missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124315701 missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124304211 missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124283659 missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124290917 missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124304203 missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124265446 missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124299045 missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124304190 missense probably damaging 1.00
R5815:Mphosph9 UTSW 5 124315418 missense probably damaging 1.00
R5993:Mphosph9 UTSW 5 124316098 missense probably benign 0.40
R6102:Mphosph9 UTSW 5 124297709 missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124320915 missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124324961 missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124298762 missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124260116 missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124290964 missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124297699 missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124261027 missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124260956 missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124297558 missense probably damaging 1.00
R7075:Mphosph9 UTSW 5 124320859 missense probably damaging 0.99
R7604:Mphosph9 UTSW 5 124316117 missense probably benign 0.01
R7808:Mphosph9 UTSW 5 124260946 missense probably damaging 0.99
R7823:Mphosph9 UTSW 5 124304256 missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
R8210:Mphosph9 UTSW 5 124267111 missense probably damaging 1.00
R8256:Mphosph9 UTSW 5 124255106 missense probably damaging 1.00
R8385:Mphosph9 UTSW 5 124312722 missense probably benign 0.19
R8438:Mphosph9 UTSW 5 124292392 missense probably benign 0.19
R8692:Mphosph9 UTSW 5 124312812 missense probably damaging 0.99
R8790:Mphosph9 UTSW 5 124315673 missense probably damaging 1.00
R8818:Mphosph9 UTSW 5 124324964 nonsense probably null
R8847:Mphosph9 UTSW 5 124316146 missense possibly damaging 0.91
R9018:Mphosph9 UTSW 5 124298650 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCCACTGTACACTTCAGAGATC -3'
(R):5'- GCTTCTTTTCTGAGAACAGTGAGAG -3'

Sequencing Primer
(F):5'- CTTCAGAGATCTTGTTTTCACCAAG -3'
(R):5'- AGAAATGAGTCTGTTGTCAGTTCCCC -3'
Posted On2019-11-26