Incidental Mutation 'R7789:Plxna4'
ID599728
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 32206233 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably null
Transcript: ENSMUST00000115096
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7635:Plxna4 UTSW 6 32496741 missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32223980 missense probably damaging 0.99
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTTCTGTGGCCTGCAC -3'
(R):5'- ATGCAGAGCCTAGATGGAATC -3'

Sequencing Primer
(F):5'- TGCACCCAGAAAGGCCTTTG -3'
(R):5'- ACTGGTATTTAGAACAGTGTGTATGC -3'
Posted On2019-11-26