Incidental Mutation 'R7789:Ankrd26'
ID599729
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118527798 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 717 (H717N)
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect probably damaging
Transcript: ENSMUST00000112830
AA Change: H717N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827
AA Change: H717N

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
murre UTSW 6 118549637 critical splice donor site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0344:Ankrd26 UTSW 6 118507637 critical splice donor site probably null
R0828:Ankrd26 UTSW 6 118533473 splice site probably benign
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2164:Ankrd26 UTSW 6 118525791 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3107:Ankrd26 UTSW 6 118556243 missense probably benign 0.01
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5639:Ankrd26 UTSW 6 118539724 missense possibly damaging 0.72
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6181:Ankrd26 UTSW 6 118548877 missense probably benign 0.15
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
R7348:Ankrd26 UTSW 6 118508564 missense probably damaging 1.00
R7414:Ankrd26 UTSW 6 118508780 missense possibly damaging 0.60
R7789:Ankrd26 UTSW 6 118527799 missense possibly damaging 0.82
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Z1177:Ankrd26 UTSW 6 118523532 missense possibly damaging 0.77
Z1177:Ankrd26 UTSW 6 118523595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTGAGTGAGTGTAACAGAACATT -3'
(R):5'- TTATTTGCAGAGCCTAGTGTAATG -3'

Sequencing Primer
(F):5'- AGTGAGTGTAACAGAACATTAAACAG -3'
(R):5'- CAGAGCCTAGTGTAATGTGTTCCTC -3'
Posted On2019-11-26