Incidental Mutation 'R7789:Trim68'
ID599738
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7789 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102684469 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000080813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082175
AA Change: D2G

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: D2G

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210855
AA Change: D2G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7892:Trim68 UTSW 7 102678797 missense unknown
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCTTGGCTTCACGGG -3'
(R):5'- GTGCACAATGTTGCCCAGTAATAG -3'

Sequencing Primer
(F):5'- CTTCACGGGAGCTCGACAAAG -3'
(R):5'- CCCAGTAATAGCTTTAGTTGAGGCC -3'
Posted On2019-11-26