Mutagenetix > Incidental Mutations

Incidental Mutation 'R7789:Mmp1a'

599746

Institutional Source

Beutler Lab

Gene Symbol

Mmp1a

Ensembl Gene

ENSMUSG00000043089

Gene Name

matrix metallopeptidase 1a (interstitial collagenase)

Synonyms

Mcol-A

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R7789 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7464141-7476869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7475265 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 345 (V345A)

Ref Sequence

ENSEMBL: ENSMUSP00000034492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034492] [ENSMUST00000217651]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034492
AA Change: V345A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000034492
Gene: ENSMUSG00000043089
AA Change: V345A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:PG_binding_1	25	84	8.2e-14	PFAM
ZnMc	97	259	2.99e-44	SMART
HX	281	323	8.12e-6	SMART
HX	325	369	7.81e-8	SMART
HX	374	421	5.82e-16	SMART
HX	423	463	2.18e0	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000217651
AA Change: Y346H

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens. Mice lacking the encoded protein exhibit decreased susceptibility to chemical carcinogen-induced lung tumor development and angiogenesis. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced inflammatory response following chemical induction of tumors and male mice exhibit fewer large induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,864,311	E163K	probably benign	Het
Adam34	T	A	8: 43,652,451	R52S	probably benign	Het
Adcy8	A	T	15: 64,871,774	C328*	probably null	Het
Ankrd26	G	T	6: 118,527,798	H717N	probably damaging	Het
Ankrd26	G	T	6: 118,527,799	S716R	possibly damaging	Het
Ankrd40	C	A	11: 94,334,709	P189T	probably damaging	Het
Anln	A	G	9: 22,352,037	S113P		Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Asxl1	C	T	2: 153,400,023	T832I	probably benign	Het
Bicd2	C	T	13: 49,379,659	R574C	probably damaging	Het
Boll	T	C	1: 55,360,667		probably null	Het
Casr	A	G	16: 36,495,291	F806L	probably damaging	Het
Casz1	C	A	4: 148,929,406	N142K	probably benign	Het
Cbl	C	T	9: 44,163,467	D433N	probably damaging	Het
Ceacam14	T	A	7: 17,814,171	V62D	probably damaging	Het
Chst10	T	C	1: 38,884,451	N18S	probably benign	Het
Cyp2j6	C	T	4: 96,545,716	R119H	probably benign	Het
Cyp4a14	C	G	4: 115,494,910	V102L	probably benign	Het
Dnajb3	A	T	1: 88,205,677	M1K	probably null	Het
Dnajc6	A	T	4: 101,618,532	K534M	possibly damaging	Het
Dnase2a	T	C	8: 84,908,876		probably null	Het
Dock10	A	G	1: 80,559,213	I985T	possibly damaging	Het
Emsy	G	T	7: 98,621,489	P436Q	probably damaging	Het
Enpp1	A	T	10: 24,654,083		probably null	Het
Erc1	T	A	6: 119,773,709	R353*	probably null	Het
Fam196b	T	A	11: 34,402,537	M193K	probably benign	Het
Fbn2	T	A	18: 58,039,313	D2140V	probably benign	Het
Fgfr1	T	A	8: 25,562,313	Y218*	probably null	Het
Fhod1	C	T	8: 105,330,108	R1045H	probably damaging	Het
Focad	G	T	4: 88,229,406	L427F	unknown	Het
Gbf1	T	A	19: 46,254,002	L144M	probably damaging	Het
Glmn	T	G	5: 107,549,075	N592T	probably benign	Het
Golgb1	C	G	16: 36,875,399	P87A	unknown	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Itga9	T	G	9: 118,658,496	F216V	possibly damaging	Het
Klhl18	T	C	9: 110,439,008	D149G	unknown	Het
Lcat	C	T	8: 105,942,225	V114M	probably benign	Het
Lrrc8c	C	A	5: 105,607,200	N280K	probably damaging	Het
Mettl8	T	C	2: 70,966,462	Y283C	probably damaging	Het
Mgat4a	A	T	1: 37,490,279	I173K	probably damaging	Het
Mok	T	A	12: 110,811,827	H215L	probably damaging	Het
Mphosph9	C	G	5: 124,315,587	E221Q	probably damaging	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myom1	A	G	17: 71,117,436	T1525A	probably benign	Het
Nap1l1	C	T	10: 111,490,456	S143L	probably benign	Het
Olfr366	C	T	2: 37,219,660	T57I	probably benign	Het
Olfr531	A	T	7: 140,400,697	Y116*	probably null	Het
Olfr646	T	A	7: 104,106,988	S236R	probably damaging	Het
Olfr847	G	T	9: 19,375,065	T272K	probably benign	Het
Plbd2	T	C	5: 120,485,754	S568G	probably damaging	Het
Plxna4	T	A	6: 32,206,233		probably null	Het
Plxnc1	T	A	10: 94,794,477	E1520V	probably damaging	Het
Ppil3	G	A	1: 58,434,379	T104I	possibly damaging	Het
Ptprm	A	T	17: 67,095,539	V118E	probably damaging	Het
Rimbp2	T	C	5: 128,774,335	D849G	probably damaging	Het
Rnf213	T	C	11: 119,470,219		probably null	Het
Sema3f	T	A	9: 107,705,432	K37N	probably benign	Het
Sh3glb1	G	T	3: 144,692,131		probably null	Het
Sh3rf3	A	G	10: 59,086,815	D571G	probably benign	Het
Sipa1l3	T	C	7: 29,377,725	Y874C	probably damaging	Het
Smchd1	G	A	17: 71,475,301		probably benign	Het
Snrnp70	A	T	7: 45,376,621	Y441*	probably null	Het
Ssrp1	C	T	2: 85,041,181	R316W	probably damaging	Het
Syt10	A	T	15: 89,826,898	V144E	probably damaging	Het
Tdrd12	A	G	7: 35,488,692	L562P		Het
Trim68	T	C	7: 102,684,469	D2G	possibly damaging	Het
Trub2	T	A	2: 29,777,908	H240L	probably damaging	Het
Tssc4	A	G	7: 143,069,778		probably null	Het
Usp7	T	A	16: 8,698,811	Q539L	probably benign	Het
Vmn2r17	T	A	5: 109,452,965	C710S	possibly damaging	Het
Vmn2r99	G	T	17: 19,393,817	V600F	possibly damaging	Het
Vps13d	C	T	4: 145,100,065	V2879M		Het
Vrtn	T	A	12: 84,650,306	M610K	probably benign	Het
Xpo4	T	C	14: 57,613,349	E366G	probably benign	Het
Zyg11a	G	A	4: 108,183,648	P703S	probably damaging	Het

Other mutations in Mmp1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00477:Mmp1a	APN	9	7476259	missense	probably benign	0.04
IGL02179:Mmp1a	APN	9	7464273	missense	probably benign	0.23
IGL02738:Mmp1a	APN	9	7464301	splice site	probably benign
IGL02984:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL02988:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL02991:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03014:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03050:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03054:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03055:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03097:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03098:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03134:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03138:Mmp1a	UTSW	9	7465083	makesense	probably null
IGL03147:Mmp1a	UTSW	9	7465083	makesense	probably null
R0095:Mmp1a	UTSW	9	7465620	missense	possibly damaging	0.51
R0095:Mmp1a	UTSW	9	7465620	missense	possibly damaging	0.51
R1422:Mmp1a	UTSW	9	7464298	splice site	probably null
R1663:Mmp1a	UTSW	9	7465656	missense	probably benign	0.33
R1801:Mmp1a	UTSW	9	7475390	missense	probably damaging	1.00
R2171:Mmp1a	UTSW	9	7475356	missense	probably damaging	0.99
R3415:Mmp1a	UTSW	9	7464869	missense	possibly damaging	0.92
R3901:Mmp1a	UTSW	9	7475345	makesense	probably null
R4175:Mmp1a	UTSW	9	7467235	missense	probably benign	0.03
R5406:Mmp1a	UTSW	9	7467293	missense	probably damaging	1.00
R6462:Mmp1a	UTSW	9	7467038	missense	probably benign	0.01
R7016:Mmp1a	UTSW	9	7465083	makesense	probably null
R7039:Mmp1a	UTSW	9	7465083	makesense	probably null
R7098:Mmp1a	UTSW	9	7475937	missense	probably benign	0.00
R7144:Mmp1a	UTSW	9	7475318	missense	probably damaging	1.00
R7196:Mmp1a	UTSW	9	7476017	nonsense	probably null
R7284:Mmp1a	UTSW	9	7465083	makesense	probably null
R7289:Mmp1a	UTSW	9	7467293	missense	probably damaging	1.00
R7313:Mmp1a	UTSW	9	7465083	makesense	probably null
R7510:Mmp1a	UTSW	9	7465083	makesense	probably null
R7537:Mmp1a	UTSW	9	7465083	makesense	probably null
R7574:Mmp1a	UTSW	9	7465083	makesense	probably null
R7626:Mmp1a	UTSW	9	7465083	makesense	probably null
R7755:Mmp1a	UTSW	9	7467004	missense	possibly damaging	0.92
R7791:Mmp1a	UTSW	9	7465083	makesense	probably null
R7900:Mmp1a	UTSW	9	7465083	makesense	probably null
R8000:Mmp1a	UTSW	9	7476214	missense	probably benign	0.11
R8009:Mmp1a	UTSW	9	7467235	missense	possibly damaging	0.76
R8039:Mmp1a	UTSW	9	7465083	makesense	probably null
R8072:Mmp1a	UTSW	9	7465083	makesense	probably null
R8497:Mmp1a	UTSW	9	7465083	makesense	probably null
RF004:Mmp1a	UTSW	9	7465083	makesense	probably null
X0020:Mmp1a	UTSW	9	7465626	missense	probably damaging	1.00
Z1177:Mmp1a	UTSW	9	7464230	missense	probably benign	0.21
Z1177:Mmp1a	UTSW	9	7467033	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TACAGATTAGAATGTCCTGGGAAG -3'
(R):5'- GAACACTCAGTGGCTACAGC -3'

Sequencing Primer
(F):5'- CTCCTAACAGTTAAGGGTCTAAGGC -3'
(R):5'- CAGTTGCTTAACATCATTTGAAATGC -3'

Posted On

2019-11-26