Incidental Mutation 'R7789:Anln'
ID 599748
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Name anillin, actin binding protein
Synonyms 1110037A17Rik, 2900037I21Rik, Scraps
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22332012-22389188 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22352037 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912] [ENSMUST00000215006]
AlphaFold Q8K298
Predicted Effect probably benign
Transcript: ENSMUST00000040912
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215006
Predicted Effect
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22360824 nonsense probably null
IGL01634:Anln APN 9 22360475 missense probably benign 0.00
IGL02145:Anln APN 9 22338996 splice site probably null
IGL02296:Anln APN 9 22372187 missense possibly damaging 0.67
IGL02352:Anln APN 9 22368412 missense probably benign 0.00
IGL02601:Anln APN 9 22338035 missense probably damaging 0.99
IGL02821:Anln APN 9 22358122 missense possibly damaging 0.55
IGL02863:Anln APN 9 22376365 missense probably damaging 1.00
IGL03274:Anln APN 9 22382269 missense probably damaging 1.00
R0114:Anln UTSW 9 22353346 missense probably damaging 0.99
R0486:Anln UTSW 9 22352826 missense probably benign 0.31
R0712:Anln UTSW 9 22380298 missense probably benign 0.01
R1618:Anln UTSW 9 22350918 critical splice donor site probably null
R1734:Anln UTSW 9 22350955 missense possibly damaging 0.71
R1856:Anln UTSW 9 22353331 missense probably damaging 1.00
R1999:Anln UTSW 9 22333052 makesense probably null
R2073:Anln UTSW 9 22333168 missense probably benign 0.45
R2075:Anln UTSW 9 22333168 missense probably benign 0.45
R2696:Anln UTSW 9 22360963 missense probably benign 0.08
R2943:Anln UTSW 9 22356046 splice site probably null
R4278:Anln UTSW 9 22334000 critical splice donor site probably null
R4548:Anln UTSW 9 22362888 missense possibly damaging 0.80
R4887:Anln UTSW 9 22380188 missense possibly damaging 0.46
R4979:Anln UTSW 9 22376501 missense probably benign
R5087:Anln UTSW 9 22375044 missense possibly damaging 0.61
R5197:Anln UTSW 9 22352781 critical splice donor site probably null
R5353:Anln UTSW 9 22360517 missense probably damaging 1.00
R5748:Anln UTSW 9 22337934 missense probably damaging 0.97
R5863:Anln UTSW 9 22337984 missense probably damaging 0.99
R6146:Anln UTSW 9 22376308 nonsense probably null
R6152:Anln UTSW 9 22360507 missense probably damaging 0.98
R6170:Anln UTSW 9 22368497 missense probably benign 0.01
R6261:Anln UTSW 9 22364046 missense probably damaging 1.00
R6264:Anln UTSW 9 22334117 missense possibly damaging 0.82
R6656:Anln UTSW 9 22351002 missense probably damaging 1.00
R6864:Anln UTSW 9 22382249 missense probably benign 0.36
R7514:Anln UTSW 9 22360857 missense probably damaging 0.96
R7807:Anln UTSW 9 22360880 missense probably damaging 1.00
R7840:Anln UTSW 9 22362723 missense probably benign 0.03
R7912:Anln UTSW 9 22358669 missense possibly damaging 0.53
R8246:Anln UTSW 9 22350955 missense probably benign 0.00
R8720:Anln UTSW 9 22373277 missense probably benign 0.00
R8839:Anln UTSW 9 22356172 missense probably benign 0.02
R9054:Anln UTSW 9 22360820 critical splice donor site probably null
R9094:Anln UTSW 9 22337987 missense probably benign 0.03
Z1088:Anln UTSW 9 22362801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAATAGCTTAGGTCCACTCACC -3'
(R):5'- GCTATTACTCCAAAGAGACTCCTC -3'

Sequencing Primer
(F):5'- TTAGGTCCACTCACCTGAAGAATG -3'
(R):5'- GAGACTCCTCACATCTATAACTTCAG -3'
Posted On 2019-11-26