Mutagenetix > Incidental Mutation

Incidental Mutation 'R7789:Cbl'

599749

Institutional Source

Beutler Lab

Gene Symbol

Cbl

Ensembl Gene

ENSMUSG00000034342

Gene Name

Casitas B-lineage lymphoma

Synonyms

Cbl-2, c-Cbl

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.668) question?

Stock #

R7789 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44142976-44234049 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 44163467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 433 (D433N)

Ref Sequence

ENSEMBL: ENSMUSP00000146244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]

AlphaFold

P22682

Predicted Effect

probably benign
Transcript: ENSMUST00000037644
AA Change: D433N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: D433N

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	34	46	N/A	INTRINSIC
Pfam:Cbl_N	49	173	9.4e-59	PFAM
Pfam:Cbl_N2	177	260	4.7e-44	PFAM
Pfam:Cbl_N3	262	347	7.2e-48	PFAM
RING	379	417	1.04e-7	SMART
low complexity region	454	463	N/A	INTRINSIC
low complexity region	530	549	N/A	INTRINSIC
UBA	864	901	3.17e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205968
AA Change: D416N

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000206147
AA Change: D433N

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206720
AA Change: D433N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,864,311	E163K	probably benign	Het
Adam34	T	A	8: 43,652,451	R52S	probably benign	Het
Adcy8	A	T	15: 64,871,774	C328*	probably null	Het
Ankrd26	G	T	6: 118,527,798	H717N	probably damaging	Het
Ankrd26	G	T	6: 118,527,799	S716R	possibly damaging	Het
Ankrd40	C	A	11: 94,334,709	P189T	probably damaging	Het
Anln	A	G	9: 22,352,037	S113P		Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Asxl1	C	T	2: 153,400,023	T832I	probably benign	Het
Bicd2	C	T	13: 49,379,659	R574C	probably damaging	Het
Boll	T	C	1: 55,360,667		probably null	Het
Casr	A	G	16: 36,495,291	F806L	probably damaging	Het
Casz1	C	A	4: 148,929,406	N142K	probably benign	Het
Ceacam14	T	A	7: 17,814,171	V62D	probably damaging	Het
Chst10	T	C	1: 38,884,451	N18S	probably benign	Het
Cyp2j6	C	T	4: 96,545,716	R119H	probably benign	Het
Cyp4a14	C	G	4: 115,494,910	V102L	probably benign	Het
Dnajb3	A	T	1: 88,205,677	M1K	probably null	Het
Dnajc6	A	T	4: 101,618,532	K534M	possibly damaging	Het
Dnase2a	T	C	8: 84,908,876		probably null	Het
Dock10	A	G	1: 80,559,213	I985T	possibly damaging	Het
Emsy	G	T	7: 98,621,489	P436Q	probably damaging	Het
Enpp1	A	T	10: 24,654,083		probably null	Het
Erc1	T	A	6: 119,773,709	R353*	probably null	Het
Fam196b	T	A	11: 34,402,537	M193K	probably benign	Het
Fbn2	T	A	18: 58,039,313	D2140V	probably benign	Het
Fgfr1	T	A	8: 25,562,313	Y218*	probably null	Het
Fhod1	C	T	8: 105,330,108	R1045H	probably damaging	Het
Focad	G	T	4: 88,229,406	L427F	unknown	Het
Gbf1	T	A	19: 46,254,002	L144M	probably damaging	Het
Glmn	T	G	5: 107,549,075	N592T	probably benign	Het
Golgb1	C	G	16: 36,875,399	P87A	unknown	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Itga9	T	G	9: 118,658,496	F216V	possibly damaging	Het
Klhl18	T	C	9: 110,439,008	D149G	unknown	Het
Lcat	C	T	8: 105,942,225	V114M	probably benign	Het
Lrrc8c	C	A	5: 105,607,200	N280K	probably damaging	Het
Mettl8	T	C	2: 70,966,462	Y283C	probably damaging	Het
Mgat4a	A	T	1: 37,490,279	I173K	probably damaging	Het
Mmp1a	T	C	9: 7,475,265	V345A	possibly damaging	Het
Mok	T	A	12: 110,811,827	H215L	probably damaging	Het
Mphosph9	C	G	5: 124,315,587	E221Q	probably damaging	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myom1	A	G	17: 71,117,436	T1525A	probably benign	Het
Nap1l1	C	T	10: 111,490,456	S143L	probably benign	Het
Olfr366	C	T	2: 37,219,660	T57I	probably benign	Het
Olfr531	A	T	7: 140,400,697	Y116*	probably null	Het
Olfr646	T	A	7: 104,106,988	S236R	probably damaging	Het
Olfr847	G	T	9: 19,375,065	T272K	probably benign	Het
Plbd2	T	C	5: 120,485,754	S568G	probably damaging	Het
Plxna4	T	A	6: 32,206,233		probably null	Het
Plxnc1	T	A	10: 94,794,477	E1520V	probably damaging	Het
Ppil3	G	A	1: 58,434,379	T104I	possibly damaging	Het
Ptprm	A	T	17: 67,095,539	V118E	probably damaging	Het
Rimbp2	T	C	5: 128,774,335	D849G	probably damaging	Het
Rnf213	T	C	11: 119,470,219		probably null	Het
Sema3f	T	A	9: 107,705,432	K37N	probably benign	Het
Sh3glb1	G	T	3: 144,692,131		probably null	Het
Sh3rf3	A	G	10: 59,086,815	D571G	probably benign	Het
Sipa1l3	T	C	7: 29,377,725	Y874C	probably damaging	Het
Smchd1	G	A	17: 71,475,301		probably benign	Het
Snrnp70	A	T	7: 45,376,621	Y441*	probably null	Het
Ssrp1	C	T	2: 85,041,181	R316W	probably damaging	Het
Syt10	A	T	15: 89,826,898	V144E	probably damaging	Het
Tdrd12	A	G	7: 35,488,692	L562P		Het
Trim68	T	C	7: 102,684,469	D2G	possibly damaging	Het
Trub2	T	A	2: 29,777,908	H240L	probably damaging	Het
Tssc4	A	G	7: 143,069,778		probably null	Het
Usp7	T	A	16: 8,698,811	Q539L	probably benign	Het
Vmn2r17	T	A	5: 109,452,965	C710S	possibly damaging	Het
Vmn2r99	G	T	17: 19,393,817	V600F	possibly damaging	Het
Vps13d	C	T	4: 145,100,065	V2879M		Het
Vrtn	T	A	12: 84,650,306	M610K	probably benign	Het
Xpo4	T	C	14: 57,613,349	E366G	probably benign	Het
Zyg11a	G	A	4: 108,183,648	P703S	probably damaging	Het

Other mutations in Cbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Cbl	APN	9	44201198	missense	probably damaging	1.00
IGL01369:Cbl	APN	9	44201061	nonsense	probably null
IGL01434:Cbl	APN	9	44164206	missense	probably damaging	0.99
IGL01866:Cbl	APN	9	44153825	nonsense	probably null
IGL02326:Cbl	APN	9	44151473	missense	possibly damaging	0.94
IGL02956:Cbl	APN	9	44169034	missense	probably damaging	1.00
Bungalow	UTSW	9	44201119	missense	probably damaging	1.00
Casita	UTSW	9	44164165	missense	probably damaging	1.00
tiny_house	UTSW	9	44164152	missense	probably damaging	1.00
R0068:Cbl	UTSW	9	44154194	missense	probably damaging	0.98
R0390:Cbl	UTSW	9	44201005	missense	probably damaging	1.00
R0655:Cbl	UTSW	9	44158752	missense	probably damaging	1.00
R0764:Cbl	UTSW	9	44164152	missense	probably damaging	1.00
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1616:Cbl	UTSW	9	44152900	missense	probably damaging	0.99
R1736:Cbl	UTSW	9	44152895	missense	possibly damaging	0.80
R1808:Cbl	UTSW	9	44164229	missense	probably damaging	1.00
R1865:Cbl	UTSW	9	44164165	missense	probably damaging	1.00
R3156:Cbl	UTSW	9	44158850	missense	possibly damaging	0.74
R3431:Cbl	UTSW	9	44151446	makesense	probably null
R4668:Cbl	UTSW	9	44153848	missense	probably benign	0.00
R4700:Cbl	UTSW	9	44173380	missense	probably damaging	1.00
R4866:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4900:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4995:Cbl	UTSW	9	44153811	missense	possibly damaging	0.62
R5014:Cbl	UTSW	9	44154399	splice site	probably null
R5324:Cbl	UTSW	9	44154254	missense	probably damaging	0.97
R5353:Cbl	UTSW	9	44173323	missense	probably damaging	1.00
R5382:Cbl	UTSW	9	44159021	missense	probably benign
R5747:Cbl	UTSW	9	44201119	missense	probably damaging	1.00
R5834:Cbl	UTSW	9	44233779	missense	probably damaging	1.00
R6307:Cbl	UTSW	9	44158512	critical splice donor site	probably null
R6755:Cbl	UTSW	9	44173374	missense	probably damaging	0.98
R7393:Cbl	UTSW	9	44154188	critical splice donor site	probably null
R7779:Cbl	UTSW	9	44159096	missense	probably benign
R8094:Cbl	UTSW	9	44163399	missense	probably benign	0.03
R8104:Cbl	UTSW	9	44158539	missense	possibly damaging	0.93
R8146:Cbl	UTSW	9	44164874	missense	probably damaging	1.00
R8340:Cbl	UTSW	9	44159000	missense	possibly damaging	0.77
R8424:Cbl	UTSW	9	44152854	missense	possibly damaging	0.51
R8920:Cbl	UTSW	9	44167273	missense	probably damaging	0.99
R9185:Cbl	UTSW	9	44152840	missense	probably damaging	1.00
X0057:Cbl	UTSW	9	44233767	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTTTCCGTCAATGTTTTATCACAG -3'
(R):5'- CTCTGAGCTATATCCTCATCAACTG -3'

Sequencing Primer
(F):5'- TAGAAATGCTGAACAAGACATCACTC -3'
(R):5'- CTGTACTTTAACCTCTGGAAACTG -3'

Posted On

2019-11-26