Mutagenetix > Incidental Mutations

Incidental Mutation 'R7789:Itga9'

599751

Institutional Source

Beutler Lab

Gene Symbol

Itga9

Ensembl Gene

ENSMUSG00000039115

Gene Name

integrin alpha 9

Synonyms

D9Ertd428e, 2610002H11Rik, 6720458D17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7789 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118606690-118901003 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 118658496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 216 (F216V)

Ref Sequence

ENSEMBL: ENSMUSP00000044227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044165]

AlphaFold

B8JK39

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044165
AA Change: F216V

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: F216V

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	105	8.95e-7	SMART
low complexity region	181	191	N/A	INTRINSIC
Int_alpha	244	297	2.12e-8	SMART
Int_alpha	301	356	1.68e-11	SMART
Int_alpha	361	416	2.9e-15	SMART
Int_alpha	423	476	1.11e-2	SMART
SCOP:d1m1xa2	626	766	3e-32	SMART
SCOP:d1m1xa3	769	970	1e-39	SMART
transmembrane domain	981	1003	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,864,311	E163K	probably benign	Het
Adam34	T	A	8: 43,652,451	R52S	probably benign	Het
Adcy8	A	T	15: 64,871,774	C328*	probably null	Het
Ankrd26	G	T	6: 118,527,798	H717N	probably damaging	Het
Ankrd26	G	T	6: 118,527,799	S716R	possibly damaging	Het
Ankrd40	C	A	11: 94,334,709	P189T	probably damaging	Het
Anln	A	G	9: 22,352,037	S113P		Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Asxl1	C	T	2: 153,400,023	T832I	probably benign	Het
Bicd2	C	T	13: 49,379,659	R574C	probably damaging	Het
Boll	T	C	1: 55,360,667		probably null	Het
Casr	A	G	16: 36,495,291	F806L	probably damaging	Het
Casz1	C	A	4: 148,929,406	N142K	probably benign	Het
Cbl	C	T	9: 44,163,467	D433N	probably damaging	Het
Ceacam14	T	A	7: 17,814,171	V62D	probably damaging	Het
Chst10	T	C	1: 38,884,451	N18S	probably benign	Het
Cyp2j6	C	T	4: 96,545,716	R119H	probably benign	Het
Cyp4a14	C	G	4: 115,494,910	V102L	probably benign	Het
Dnajb3	A	T	1: 88,205,677	M1K	probably null	Het
Dnajc6	A	T	4: 101,618,532	K534M	possibly damaging	Het
Dnase2a	T	C	8: 84,908,876		probably null	Het
Dock10	A	G	1: 80,559,213	I985T	possibly damaging	Het
Emsy	G	T	7: 98,621,489	P436Q	probably damaging	Het
Enpp1	A	T	10: 24,654,083		probably null	Het
Erc1	T	A	6: 119,773,709	R353*	probably null	Het
Fam196b	T	A	11: 34,402,537	M193K	probably benign	Het
Fbn2	T	A	18: 58,039,313	D2140V	probably benign	Het
Fgfr1	T	A	8: 25,562,313	Y218*	probably null	Het
Fhod1	C	T	8: 105,330,108	R1045H	probably damaging	Het
Focad	G	T	4: 88,229,406	L427F	unknown	Het
Gbf1	T	A	19: 46,254,002	L144M	probably damaging	Het
Glmn	T	G	5: 107,549,075	N592T	probably benign	Het
Golgb1	C	G	16: 36,875,399	P87A	unknown	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Klhl18	T	C	9: 110,439,008	D149G	unknown	Het
Lcat	C	T	8: 105,942,225	V114M	probably benign	Het
Lrrc8c	C	A	5: 105,607,200	N280K	probably damaging	Het
Mettl8	T	C	2: 70,966,462	Y283C	probably damaging	Het
Mgat4a	A	T	1: 37,490,279	I173K	probably damaging	Het
Mmp1a	T	C	9: 7,475,265	V345A	possibly damaging	Het
Mok	T	A	12: 110,811,827	H215L	probably damaging	Het
Mphosph9	C	G	5: 124,315,587	E221Q	probably damaging	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myom1	A	G	17: 71,117,436	T1525A	probably benign	Het
Nap1l1	C	T	10: 111,490,456	S143L	probably benign	Het
Olfr366	C	T	2: 37,219,660	T57I	probably benign	Het
Olfr531	A	T	7: 140,400,697	Y116*	probably null	Het
Olfr646	T	A	7: 104,106,988	S236R	probably damaging	Het
Olfr847	G	T	9: 19,375,065	T272K	probably benign	Het
Plbd2	T	C	5: 120,485,754	S568G	probably damaging	Het
Plxna4	T	A	6: 32,206,233		probably null	Het
Plxnc1	T	A	10: 94,794,477	E1520V	probably damaging	Het
Ppil3	G	A	1: 58,434,379	T104I	possibly damaging	Het
Ptprm	A	T	17: 67,095,539	V118E	probably damaging	Het
Rimbp2	T	C	5: 128,774,335	D849G	probably damaging	Het
Rnf213	T	C	11: 119,470,219		probably null	Het
Sema3f	T	A	9: 107,705,432	K37N	probably benign	Het
Sh3glb1	G	T	3: 144,692,131		probably null	Het
Sh3rf3	A	G	10: 59,086,815	D571G	probably benign	Het
Sipa1l3	T	C	7: 29,377,725	Y874C	probably damaging	Het
Smchd1	G	A	17: 71,475,301		probably benign	Het
Snrnp70	A	T	7: 45,376,621	Y441*	probably null	Het
Ssrp1	C	T	2: 85,041,181	R316W	probably damaging	Het
Syt10	A	T	15: 89,826,898	V144E	probably damaging	Het
Tdrd12	A	G	7: 35,488,692	L562P		Het
Trim68	T	C	7: 102,684,469	D2G	possibly damaging	Het
Trub2	T	A	2: 29,777,908	H240L	probably damaging	Het
Tssc4	A	G	7: 143,069,778		probably null	Het
Usp7	T	A	16: 8,698,811	Q539L	probably benign	Het
Vmn2r17	T	A	5: 109,452,965	C710S	possibly damaging	Het
Vmn2r99	G	T	17: 19,393,817	V600F	possibly damaging	Het
Vps13d	C	T	4: 145,100,065	V2879M		Het
Vrtn	T	A	12: 84,650,306	M610K	probably benign	Het
Xpo4	T	C	14: 57,613,349	E366G	probably benign	Het
Zyg11a	G	A	4: 108,183,648	P703S	probably damaging	Het

Other mutations in Itga9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Itga9	APN	9	118769159	start codon destroyed	probably null	0.02
IGL01396:Itga9	APN	9	118607123	splice site	probably benign
IGL01476:Itga9	APN	9	118607111	missense	probably damaging	1.00
IGL01573:Itga9	APN	9	118877230	splice site	probably benign
IGL01958:Itga9	APN	9	118636494	splice site	probably benign
IGL02060:Itga9	APN	9	118661432	missense	probably damaging	1.00
IGL02146:Itga9	APN	9	118834332	missense	possibly damaging	0.50
IGL02391:Itga9	APN	9	118850805	missense	probably benign	0.19
IGL02947:Itga9	APN	9	118658533	missense	probably damaging	1.00
IGL03014:Itga9	UTSW	9	118628144	missense	probably benign
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0142:Itga9	UTSW	9	118636586	missense	probably damaging	0.96
R0179:Itga9	UTSW	9	118661386	missense	probably benign	0.11
R0207:Itga9	UTSW	9	118769253	splice site	probably benign
R0364:Itga9	UTSW	9	118841142	missense	probably benign
R0458:Itga9	UTSW	9	118681028	critical splice donor site	probably null
R1486:Itga9	UTSW	9	118626450	missense	probably damaging	0.98
R1589:Itga9	UTSW	9	118607117	critical splice donor site	probably null
R1620:Itga9	UTSW	9	118843502	missense	probably benign	0.00
R1711:Itga9	UTSW	9	118698461	missense	probably benign	0.00
R1721:Itga9	UTSW	9	118698306	splice site	probably benign
R2064:Itga9	UTSW	9	118807293	missense	probably damaging	0.99
R2201:Itga9	UTSW	9	118877115	splice site	probably benign
R2851:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R2853:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R3962:Itga9	UTSW	9	118628186	missense	possibly damaging	0.57
R4180:Itga9	UTSW	9	118607078	missense	probably damaging	1.00
R4597:Itga9	UTSW	9	118843514	missense	probably damaging	1.00
R4716:Itga9	UTSW	9	118681758	missense	probably damaging	0.98
R4929:Itga9	UTSW	9	118807249	missense	probably damaging	1.00
R5002:Itga9	UTSW	9	118663898	nonsense	probably null
R5279:Itga9	UTSW	9	118628205	missense	probably damaging	1.00
R5542:Itga9	UTSW	9	118843661	missense	possibly damaging	0.86
R5869:Itga9	UTSW	9	118663889	missense	probably damaging	1.00
R6372:Itga9	UTSW	9	118897321	missense	probably damaging	1.00
R6470:Itga9	UTSW	9	118897267	missense	probably damaging	0.99
R6581:Itga9	UTSW	9	118658564	missense	probably benign	0.00
R6919:Itga9	UTSW	9	118887815	missense	probably damaging	1.00
R7034:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7036:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7043:Itga9	UTSW	9	118769116	missense	probably damaging	0.96
R7237:Itga9	UTSW	9	118636602	missense	probably benign	0.09
R7491:Itga9	UTSW	9	118769111	missense	probably damaging	0.99
R7629:Itga9	UTSW	9	118698446	missense	probably benign	0.00
R7774:Itga9	UTSW	9	118871900	missense	probably damaging	1.00
R7782:Itga9	UTSW	9	118843644	missense
R7904:Itga9	UTSW	9	118877226	splice site	probably null
R8086:Itga9	UTSW	9	118850801	missense	probably benign
R8158:Itga9	UTSW	9	118877143	missense	probably damaging	0.99
R8204:Itga9	UTSW	9	118871921	missense	probably damaging	1.00
R8895:Itga9	UTSW	9	118681767	missense	probably damaging	1.00
R9074:Itga9	UTSW	9	118807276	missense	probably damaging	1.00
R9090:Itga9	UTSW	9	118671791	missense	possibly damaging	0.93
R9271:Itga9	UTSW	9	118671791	missense	possibly damaging	0.93
R9318:Itga9	UTSW	9	118626468	missense	probably benign	0.03
R9434:Itga9	UTSW	9	118807247	missense	probably damaging	1.00
Z1176:Itga9	UTSW	9	118843530	missense	probably benign	0.00
Z1176:Itga9	UTSW	9	118887839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGGAAATCCTAGCAAC -3'
(R):5'- AAAGGCCAACTACTGCTTCTC -3'

Sequencing Primer
(F):5'- CATGATAGACTCCAGATTGCCCAGG -3'
(R):5'- AGAGTGATACTCCATGAGCTCTTG -3'

Posted On

2019-11-26