Incidental Mutation 'R7789:Itga9'
ID 599751
Institutional Source Beutler Lab
Gene Symbol Itga9
Ensembl Gene ENSMUSG00000039115
Gene Name integrin alpha 9
Synonyms D9Ertd428e, 2610002H11Rik, 6720458D17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 118606690-118901003 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118658496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 216 (F216V)
Ref Sequence ENSEMBL: ENSMUSP00000044227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044165]
AlphaFold B8JK39
Predicted Effect possibly damaging
Transcript: ENSMUST00000044165
AA Change: F216V

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: F216V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 105 8.95e-7 SMART
low complexity region 181 191 N/A INTRINSIC
Int_alpha 244 297 2.12e-8 SMART
Int_alpha 301 356 1.68e-11 SMART
Int_alpha 361 416 2.9e-15 SMART
Int_alpha 423 476 1.11e-2 SMART
SCOP:d1m1xa2 626 766 3e-32 SMART
SCOP:d1m1xa3 769 970 1e-39 SMART
transmembrane domain 981 1003 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Itga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Itga9 APN 9 118769159 start codon destroyed probably null 0.02
IGL01396:Itga9 APN 9 118607123 splice site probably benign
IGL01476:Itga9 APN 9 118607111 missense probably damaging 1.00
IGL01573:Itga9 APN 9 118877230 splice site probably benign
IGL01958:Itga9 APN 9 118636494 splice site probably benign
IGL02060:Itga9 APN 9 118661432 missense probably damaging 1.00
IGL02146:Itga9 APN 9 118834332 missense possibly damaging 0.50
IGL02391:Itga9 APN 9 118850805 missense probably benign 0.19
IGL02947:Itga9 APN 9 118658533 missense probably damaging 1.00
IGL03014:Itga9 UTSW 9 118628144 missense probably benign
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0142:Itga9 UTSW 9 118636586 missense probably damaging 0.96
R0179:Itga9 UTSW 9 118661386 missense probably benign 0.11
R0207:Itga9 UTSW 9 118769253 splice site probably benign
R0364:Itga9 UTSW 9 118841142 missense probably benign
R0458:Itga9 UTSW 9 118681028 critical splice donor site probably null
R1486:Itga9 UTSW 9 118626450 missense probably damaging 0.98
R1589:Itga9 UTSW 9 118607117 critical splice donor site probably null
R1620:Itga9 UTSW 9 118843502 missense probably benign 0.00
R1711:Itga9 UTSW 9 118698461 missense probably benign 0.00
R1721:Itga9 UTSW 9 118698306 splice site probably benign
R2064:Itga9 UTSW 9 118807293 missense probably damaging 0.99
R2201:Itga9 UTSW 9 118877115 splice site probably benign
R2851:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R2853:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R3962:Itga9 UTSW 9 118628186 missense possibly damaging 0.57
R4180:Itga9 UTSW 9 118607078 missense probably damaging 1.00
R4597:Itga9 UTSW 9 118843514 missense probably damaging 1.00
R4716:Itga9 UTSW 9 118681758 missense probably damaging 0.98
R4929:Itga9 UTSW 9 118807249 missense probably damaging 1.00
R5002:Itga9 UTSW 9 118663898 nonsense probably null
R5279:Itga9 UTSW 9 118628205 missense probably damaging 1.00
R5542:Itga9 UTSW 9 118843661 missense possibly damaging 0.86
R5869:Itga9 UTSW 9 118663889 missense probably damaging 1.00
R6372:Itga9 UTSW 9 118897321 missense probably damaging 1.00
R6470:Itga9 UTSW 9 118897267 missense probably damaging 0.99
R6581:Itga9 UTSW 9 118658564 missense probably benign 0.00
R6919:Itga9 UTSW 9 118887815 missense probably damaging 1.00
R7034:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7036:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7043:Itga9 UTSW 9 118769116 missense probably damaging 0.96
R7237:Itga9 UTSW 9 118636602 missense probably benign 0.09
R7491:Itga9 UTSW 9 118769111 missense probably damaging 0.99
R7629:Itga9 UTSW 9 118698446 missense probably benign 0.00
R7774:Itga9 UTSW 9 118871900 missense probably damaging 1.00
R7782:Itga9 UTSW 9 118843644 missense
R7904:Itga9 UTSW 9 118877226 splice site probably null
R8086:Itga9 UTSW 9 118850801 missense probably benign
R8158:Itga9 UTSW 9 118877143 missense probably damaging 0.99
R8204:Itga9 UTSW 9 118871921 missense probably damaging 1.00
R8895:Itga9 UTSW 9 118681767 missense probably damaging 1.00
R9074:Itga9 UTSW 9 118807276 missense probably damaging 1.00
R9090:Itga9 UTSW 9 118671791 missense possibly damaging 0.93
R9271:Itga9 UTSW 9 118671791 missense possibly damaging 0.93
R9318:Itga9 UTSW 9 118626468 missense probably benign 0.03
R9434:Itga9 UTSW 9 118807247 missense probably damaging 1.00
Z1176:Itga9 UTSW 9 118843530 missense probably benign 0.00
Z1176:Itga9 UTSW 9 118887839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGGAAATCCTAGCAAC -3'
(R):5'- AAAGGCCAACTACTGCTTCTC -3'

Sequencing Primer
(F):5'- CATGATAGACTCCAGATTGCCCAGG -3'
(R):5'- AGAGTGATACTCCATGAGCTCTTG -3'
Posted On 2019-11-26