Mutagenetix > Incidental Mutation

Incidental Mutation 'R7789:Arid5b'

599753

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R7789 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68098587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 495 (G495E)

Ref Sequence

ENSEMBL: ENSMUSP00000151227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably benign
Transcript: ENSMUST00000020106

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218532
AA Change: G252E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000219238
AA Change: G495E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,864,311	E163K	probably benign	Het
Adam34	T	A	8: 43,652,451	R52S	probably benign	Het
Adcy8	A	T	15: 64,871,774	C328*	probably null	Het
Ankrd26	G	T	6: 118,527,798	H717N	probably damaging	Het
Ankrd26	G	T	6: 118,527,799	S716R	possibly damaging	Het
Ankrd40	C	A	11: 94,334,709	P189T	probably damaging	Het
Anln	A	G	9: 22,352,037	S113P		Het
Asxl1	C	T	2: 153,400,023	T832I	probably benign	Het
Bicd2	C	T	13: 49,379,659	R574C	probably damaging	Het
Boll	T	C	1: 55,360,667		probably null	Het
Casr	A	G	16: 36,495,291	F806L	probably damaging	Het
Casz1	C	A	4: 148,929,406	N142K	probably benign	Het
Cbl	C	T	9: 44,163,467	D433N	probably damaging	Het
Ceacam14	T	A	7: 17,814,171	V62D	probably damaging	Het
Chst10	T	C	1: 38,884,451	N18S	probably benign	Het
Cyp2j6	C	T	4: 96,545,716	R119H	probably benign	Het
Cyp4a14	C	G	4: 115,494,910	V102L	probably benign	Het
Dnajb3	A	T	1: 88,205,677	M1K	probably null	Het
Dnajc6	A	T	4: 101,618,532	K534M	possibly damaging	Het
Dnase2a	T	C	8: 84,908,876		probably null	Het
Dock10	A	G	1: 80,559,213	I985T	possibly damaging	Het
Emsy	G	T	7: 98,621,489	P436Q	probably damaging	Het
Enpp1	A	T	10: 24,654,083		probably null	Het
Erc1	T	A	6: 119,773,709	R353*	probably null	Het
Fam196b	T	A	11: 34,402,537	M193K	probably benign	Het
Fbn2	T	A	18: 58,039,313	D2140V	probably benign	Het
Fgfr1	T	A	8: 25,562,313	Y218*	probably null	Het
Fhod1	C	T	8: 105,330,108	R1045H	probably damaging	Het
Focad	G	T	4: 88,229,406	L427F	unknown	Het
Gbf1	T	A	19: 46,254,002	L144M	probably damaging	Het
Glmn	T	G	5: 107,549,075	N592T	probably benign	Het
Golgb1	C	G	16: 36,875,399	P87A	unknown	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Itga9	T	G	9: 118,658,496	F216V	possibly damaging	Het
Klhl18	T	C	9: 110,439,008	D149G	unknown	Het
Lcat	C	T	8: 105,942,225	V114M	probably benign	Het
Lrrc8c	C	A	5: 105,607,200	N280K	probably damaging	Het
Mettl8	T	C	2: 70,966,462	Y283C	probably damaging	Het
Mgat4a	A	T	1: 37,490,279	I173K	probably damaging	Het
Mmp1a	T	C	9: 7,475,265	V345A	possibly damaging	Het
Mok	T	A	12: 110,811,827	H215L	probably damaging	Het
Mphosph9	C	G	5: 124,315,587	E221Q	probably damaging	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Myom1	A	G	17: 71,117,436	T1525A	probably benign	Het
Nap1l1	C	T	10: 111,490,456	S143L	probably benign	Het
Olfr366	C	T	2: 37,219,660	T57I	probably benign	Het
Olfr531	A	T	7: 140,400,697	Y116*	probably null	Het
Olfr646	T	A	7: 104,106,988	S236R	probably damaging	Het
Olfr847	G	T	9: 19,375,065	T272K	probably benign	Het
Plbd2	T	C	5: 120,485,754	S568G	probably damaging	Het
Plxna4	T	A	6: 32,206,233		probably null	Het
Plxnc1	T	A	10: 94,794,477	E1520V	probably damaging	Het
Ppil3	G	A	1: 58,434,379	T104I	possibly damaging	Het
Ptprm	A	T	17: 67,095,539	V118E	probably damaging	Het
Rimbp2	T	C	5: 128,774,335	D849G	probably damaging	Het
Rnf213	T	C	11: 119,470,219		probably null	Het
Sema3f	T	A	9: 107,705,432	K37N	probably benign	Het
Sh3glb1	G	T	3: 144,692,131		probably null	Het
Sh3rf3	A	G	10: 59,086,815	D571G	probably benign	Het
Sipa1l3	T	C	7: 29,377,725	Y874C	probably damaging	Het
Smchd1	G	A	17: 71,475,301		probably benign	Het
Snrnp70	A	T	7: 45,376,621	Y441*	probably null	Het
Ssrp1	C	T	2: 85,041,181	R316W	probably damaging	Het
Syt10	A	T	15: 89,826,898	V144E	probably damaging	Het
Tdrd12	A	G	7: 35,488,692	L562P		Het
Trim68	T	C	7: 102,684,469	D2G	possibly damaging	Het
Trub2	T	A	2: 29,777,908	H240L	probably damaging	Het
Tssc4	A	G	7: 143,069,778		probably null	Het
Usp7	T	A	16: 8,698,811	Q539L	probably benign	Het
Vmn2r17	T	A	5: 109,452,965	C710S	possibly damaging	Het
Vmn2r99	G	T	17: 19,393,817	V600F	possibly damaging	Het
Vps13d	C	T	4: 145,100,065	V2879M		Het
Vrtn	T	A	12: 84,650,306	M610K	probably benign	Het
Xpo4	T	C	14: 57,613,349	E366G	probably benign	Het
Zyg11a	G	A	4: 108,183,648	P703S	probably damaging	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTTGAGTCCATCTGGGTGC -3'
(R):5'- CTGGCTTCAAGGATAACTGCTG -3'

Sequencing Primer
(F):5'- CTGTTTGCCAGCCCCAG -3'
(R):5'- CAAGGATAACTGCTGTGTGTGATAC -3'

Posted On

2019-11-26