Incidental Mutation 'R7789:Ankrd40'
ID 599757
Institutional Source Beutler Lab
Gene Symbol Ankrd40
Ensembl Gene ENSMUSG00000020864
Gene Name ankyrin repeat domain 40
Synonyms 1110011C06Rik, 5530600A18Rik, Gcap15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 94328001-94341841 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 94334709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 189 (P189T)
Ref Sequence ENSEMBL: ENSMUSP00000061637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021227] [ENSMUST00000051221] [ENSMUST00000107818] [ENSMUST00000149867]
AlphaFold Q5SUE8
Predicted Effect possibly damaging
Transcript: ENSMUST00000021227
AA Change: P189T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021227
Gene: ENSMUSG00000020864
AA Change: P189T

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051221
AA Change: P189T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061637
Gene: ENSMUSG00000020864
AA Change: P189T

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107818
AA Change: P189T

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103448
Gene: ENSMUSG00000020864
AA Change: P189T

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149867
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Ankrd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
G1patch:Ankrd40 UTSW 11 94334815 missense probably benign 0.01
R0621:Ankrd40 UTSW 11 94339607 splice site probably null
R2873:Ankrd40 UTSW 11 94333945 missense possibly damaging 0.62
R4817:Ankrd40 UTSW 11 94339633 missense probably benign 0.00
R4931:Ankrd40 UTSW 11 94334821 missense probably benign 0.41
R5026:Ankrd40 UTSW 11 94339724 unclassified probably benign
R5504:Ankrd40 UTSW 11 94328327 missense probably benign 0.31
R5891:Ankrd40 UTSW 11 94334863 missense probably damaging 1.00
R6089:Ankrd40 UTSW 11 94333925 missense probably damaging 1.00
R6725:Ankrd40 UTSW 11 94334815 missense probably benign 0.01
R8179:Ankrd40 UTSW 11 94334715 missense probably benign 0.00
R8376:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8378:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8419:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8421:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R9090:Ankrd40 UTSW 11 94334436 missense probably benign 0.05
R9264:Ankrd40 UTSW 11 94338361 missense probably damaging 1.00
R9271:Ankrd40 UTSW 11 94334436 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TATCTACACCCCTGCAGCAG -3'
(R):5'- AGAGGCTGTGTGCTGTTACC -3'

Sequencing Primer
(F):5'- GAAGACTCCACCCAATTGCAGAATG -3'
(R):5'- CCTTGCATATTAAATGGAAATGCTCC -3'
Posted On 2019-11-26