Incidental Mutation 'R7789:Vrtn'
ID 599758
Institutional Source Beutler Lab
Gene Symbol Vrtn
Ensembl Gene ENSMUSG00000071235
Gene Name vertebrae development associated
Synonyms 7420416P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 84641019-84651455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84650306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 610 (M610K)
Ref Sequence ENSEMBL: ENSMUSP00000093207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095551] [ENSMUST00000166772] [ENSMUST00000167227] [ENSMUST00000221915] [ENSMUST00000222319]
AlphaFold Q3SYK4
Predicted Effect probably benign
Transcript: ENSMUST00000095551
AA Change: M610K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093207
Gene: ENSMUSG00000071235
AA Change: M610K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000166772
AA Change: M610K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128808
Gene: ENSMUSG00000071235
AA Change: M610K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000167227
AA Change: M610K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132050
Gene: ENSMUSG00000071235
AA Change: M610K

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000221915
Predicted Effect probably benign
Transcript: ENSMUST00000222319
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Vrtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Vrtn APN 12 84649063 missense probably benign 0.01
IGL01777:Vrtn APN 12 84648922 missense probably benign 0.13
IGL01911:Vrtn APN 12 84650206 missense probably benign
IGL02219:Vrtn APN 12 84648833 missense probably damaging 1.00
IGL02684:Vrtn APN 12 84650149 missense probably benign
IGL02947:Vrtn APN 12 84648484 missense probably damaging 0.98
IGL03296:Vrtn APN 12 84648848 missense probably damaging 1.00
PIT4378001:Vrtn UTSW 12 84649169 missense probably damaging 0.99
R0044:Vrtn UTSW 12 84648605 missense probably damaging 1.00
R1546:Vrtn UTSW 12 84648508 missense probably damaging 1.00
R1584:Vrtn UTSW 12 84650081 missense probably damaging 1.00
R1693:Vrtn UTSW 12 84648655 missense probably benign 0.03
R1773:Vrtn UTSW 12 84650224 missense probably damaging 0.98
R1951:Vrtn UTSW 12 84649199 missense probably damaging 1.00
R2143:Vrtn UTSW 12 84650162 missense probably benign 0.00
R4044:Vrtn UTSW 12 84649070 missense probably damaging 1.00
R4777:Vrtn UTSW 12 84648826 missense probably damaging 1.00
R4835:Vrtn UTSW 12 84649694 missense probably damaging 0.97
R5076:Vrtn UTSW 12 84649474 missense probably damaging 1.00
R5783:Vrtn UTSW 12 84650477 missense probably benign 0.31
R5831:Vrtn UTSW 12 84648575 missense probably damaging 1.00
R6349:Vrtn UTSW 12 84649018 missense probably damaging 1.00
R6499:Vrtn UTSW 12 84650316 missense probably benign 0.01
R6931:Vrtn UTSW 12 84650242 missense probably benign
R7192:Vrtn UTSW 12 84648862 missense probably damaging 0.98
R8059:Vrtn UTSW 12 84649916 missense probably benign
R8095:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8096:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8136:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8142:Vrtn UTSW 12 84650621 missense probably damaging 1.00
R8557:Vrtn UTSW 12 84649916 missense probably benign
R9165:Vrtn UTSW 12 84650477 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAAAGTCTTTCCCGGAGATCG -3'
(R):5'- TGGTAAGCATGTCCATCACCAG -3'

Sequencing Primer
(F):5'- ATCGCCCGGGATGCAGATTC -3'
(R):5'- TGTCCATCACCAGCACCTG -3'
Posted On 2019-11-26