Incidental Mutation 'R7789:Bicd2'
ID599760
Institutional Source Beutler Lab
Gene Symbol Bicd2
Ensembl Gene ENSMUSG00000037933
Gene NameBICD cargo adaptor 2
Synonyms0610027D24Rik, 1110005D12Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.639) question?
Stock #R7789 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49341585-49387026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49379659 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 574 (R574C)
Ref Sequence ENSEMBL: ENSMUSP00000039394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085] [ENSMUST00000220723]
Predicted Effect probably damaging
Transcript: ENSMUST00000048544
AA Change: R574C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: R574C

DomainStartEndE-ValueType
internal_repeat_1 22 50 2.25e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110084
AA Change: R500C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: R500C

DomainStartEndE-ValueType
Pfam:BicD 9 723 N/A PFAM
low complexity region 733 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110085
AA Change: R574C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: R574C

DomainStartEndE-ValueType
internal_repeat_1 22 50 1.16e-5 PROSPERO
Pfam:BicD 83 797 N/A PFAM
low complexity region 807 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220723
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Bicd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Bicd2 APN 13 49378316 missense probably damaging 1.00
IGL02029:Bicd2 APN 13 49369499 missense probably damaging 1.00
IGL02052:Bicd2 APN 13 49379189 missense possibly damaging 0.91
IGL02955:Bicd2 APN 13 49378215 missense probably benign
IGL03033:Bicd2 APN 13 49379920 missense probably benign 0.09
IGL03395:Bicd2 APN 13 49375258 missense probably damaging 1.00
IGL02802:Bicd2 UTSW 13 49378328 missense probably damaging 1.00
P0027:Bicd2 UTSW 13 49379651 missense probably benign 0.05
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0052:Bicd2 UTSW 13 49375314 missense probably damaging 1.00
R0393:Bicd2 UTSW 13 49379870 missense probably damaging 1.00
R0718:Bicd2 UTSW 13 49377875 splice site probably null
R0730:Bicd2 UTSW 13 49378241 missense possibly damaging 0.77
R1716:Bicd2 UTSW 13 49378310 missense probably benign
R2004:Bicd2 UTSW 13 49379405 missense possibly damaging 0.50
R2041:Bicd2 UTSW 13 49341776 missense probably benign 0.02
R2151:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2152:Bicd2 UTSW 13 49379576 missense probably damaging 1.00
R2444:Bicd2 UTSW 13 49379024 missense probably benign 0.00
R4085:Bicd2 UTSW 13 49384962 splice site probably null
R4477:Bicd2 UTSW 13 49377972 missense probably damaging 1.00
R4824:Bicd2 UTSW 13 49379012 missense probably damaging 1.00
R4979:Bicd2 UTSW 13 49379464 missense possibly damaging 0.89
R6348:Bicd2 UTSW 13 49379846 missense probably damaging 1.00
R7317:Bicd2 UTSW 13 49378308 missense probably damaging 1.00
R7326:Bicd2 UTSW 13 49369609 missense probably benign 0.43
R7395:Bicd2 UTSW 13 49378230 missense possibly damaging 0.79
R7448:Bicd2 UTSW 13 49379951 missense probably damaging 1.00
T0722:Bicd2 UTSW 13 49379651 missense probably benign 0.05
X0003:Bicd2 UTSW 13 49379651 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCTGCTGGAGAAGGCTAG -3'
(R):5'- ATCTGGTCTCGGATGATGGC -3'

Sequencing Primer
(F):5'- TGCTGGCCCATCTGGAAAAG -3'
(R):5'- CTCGGATGATGGCGATCAG -3'
Posted On2019-11-26