Incidental Mutation 'R7789:Golgb1'
ID 599768
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 045845-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 36695761 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Alanine at position 87 (P87A)
Ref Sequence ENSEMBL: ENSMUSP00000023534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023534] [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114812] [ENSMUST00000114819] [ENSMUST00000134616]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000023534
AA Change: P87A
SMART Domains Protein: ENSMUSP00000023534
Gene: ENSMUSG00000034243
AA Change: P87A

DomainStartEndE-ValueType
low complexity region 55 99 N/A INTRINSIC
low complexity region 109 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023535
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,682,175 (GRCm39) E163K probably benign Het
Adam34 T A 8: 44,105,488 (GRCm39) R52S probably benign Het
Adcy8 A T 15: 64,743,623 (GRCm39) C328* probably null Het
Ankrd26 G T 6: 118,504,760 (GRCm39) S716R possibly damaging Het
Ankrd26 G T 6: 118,504,759 (GRCm39) H717N probably damaging Het
Ankrd40 C A 11: 94,225,535 (GRCm39) P189T probably damaging Het
Anln A G 9: 22,263,333 (GRCm39) S113P Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Asxl1 C T 2: 153,241,943 (GRCm39) T832I probably benign Het
Bicd2 C T 13: 49,533,135 (GRCm39) R574C probably damaging Het
Boll T C 1: 55,399,826 (GRCm39) probably null Het
Casr A G 16: 36,315,653 (GRCm39) F806L probably damaging Het
Casz1 C A 4: 149,013,863 (GRCm39) N142K probably benign Het
Cbl C T 9: 44,074,764 (GRCm39) D433N probably damaging Het
Ceacam14 T A 7: 17,548,096 (GRCm39) V62D probably damaging Het
Chst10 T C 1: 38,923,532 (GRCm39) N18S probably benign Het
Cyp2j6 C T 4: 96,433,953 (GRCm39) R119H probably benign Het
Cyp4a14 C G 4: 115,352,107 (GRCm39) V102L probably benign Het
Dnajb3 A T 1: 88,133,399 (GRCm39) M1K probably null Het
Dnajc6 A T 4: 101,475,729 (GRCm39) K534M possibly damaging Het
Dnase2a T C 8: 85,635,505 (GRCm39) probably null Het
Dock10 A G 1: 80,536,930 (GRCm39) I985T possibly damaging Het
Emsy G T 7: 98,270,696 (GRCm39) P436Q probably damaging Het
Enpp1 A T 10: 24,529,981 (GRCm39) probably null Het
Erc1 T A 6: 119,750,670 (GRCm39) R353* probably null Het
Fbn2 T A 18: 58,172,385 (GRCm39) D2140V probably benign Het
Fgfr1 T A 8: 26,052,329 (GRCm39) Y218* probably null Het
Fhod1 C T 8: 106,056,740 (GRCm39) R1045H probably damaging Het
Focad G T 4: 88,147,643 (GRCm39) L427F unknown Het
Gbf1 T A 19: 46,242,441 (GRCm39) L144M probably damaging Het
Glmn T G 5: 107,696,941 (GRCm39) N592T probably benign Het
H2bw2 G A X: 135,828,471 (GRCm39) R120K unknown Het
Insyn2b T A 11: 34,352,537 (GRCm39) M193K probably benign Het
Itga9 T G 9: 118,487,564 (GRCm39) F216V possibly damaging Het
Klhl18 T C 9: 110,268,076 (GRCm39) D149G unknown Het
Lcat C T 8: 106,668,857 (GRCm39) V114M probably benign Het
Lrrc8c C A 5: 105,755,066 (GRCm39) N280K probably damaging Het
Mettl8 T C 2: 70,796,806 (GRCm39) Y283C probably damaging Het
Mgat4a A T 1: 37,529,360 (GRCm39) I173K probably damaging Het
Mmp1a T C 9: 7,475,266 (GRCm39) V345A possibly damaging Het
Mok T A 12: 110,778,261 (GRCm39) H215L probably damaging Het
Mphosph9 C G 5: 124,453,650 (GRCm39) E221Q probably damaging Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Myom1 A G 17: 71,424,431 (GRCm39) T1525A probably benign Het
Nap1l1 C T 10: 111,326,317 (GRCm39) S143L probably benign Het
Or1af1 C T 2: 37,109,672 (GRCm39) T57I probably benign Het
Or2j6 A T 7: 139,980,610 (GRCm39) Y116* probably null Het
Or52d1 T A 7: 103,756,195 (GRCm39) S236R probably damaging Het
Or7g29 G T 9: 19,286,361 (GRCm39) T272K probably benign Het
Plbd2 T C 5: 120,623,819 (GRCm39) S568G probably damaging Het
Plxna4 T A 6: 32,183,168 (GRCm39) probably null Het
Plxnc1 T A 10: 94,630,339 (GRCm39) E1520V probably damaging Het
Ppil3 G A 1: 58,473,538 (GRCm39) T104I possibly damaging Het
Ptprm A T 17: 67,402,534 (GRCm39) V118E probably damaging Het
Rimbp2 T C 5: 128,851,399 (GRCm39) D849G probably damaging Het
Rnf213 T C 11: 119,361,045 (GRCm39) probably null Het
Sema3f T A 9: 107,582,631 (GRCm39) K37N probably benign Het
Sh3glb1 G T 3: 144,397,892 (GRCm39) probably null Het
Sh3rf3 A G 10: 58,922,637 (GRCm39) D571G probably benign Het
Sipa1l3 T C 7: 29,077,150 (GRCm39) Y874C probably damaging Het
Smchd1 G A 17: 71,782,296 (GRCm39) probably benign Het
Snrnp70 A T 7: 45,026,045 (GRCm39) Y441* probably null Het
Ssrp1 C T 2: 84,871,525 (GRCm39) R316W probably damaging Het
Syt10 A T 15: 89,711,101 (GRCm39) V144E probably damaging Het
Tdrd12 A G 7: 35,188,117 (GRCm39) L562P Het
Trim68 T C 7: 102,333,676 (GRCm39) D2G possibly damaging Het
Trub2 T A 2: 29,667,920 (GRCm39) H240L probably damaging Het
Tssc4 A G 7: 142,623,515 (GRCm39) probably null Het
Usp7 T A 16: 8,516,675 (GRCm39) Q539L probably benign Het
Vmn2r17 T A 5: 109,600,831 (GRCm39) C710S possibly damaging Het
Vmn2r99 G T 17: 19,614,079 (GRCm39) V600F possibly damaging Het
Vps13d C T 4: 144,826,635 (GRCm39) V2879M Het
Vrtn T A 12: 84,697,080 (GRCm39) M610K probably benign Het
Xpo4 T C 14: 57,850,806 (GRCm39) E366G probably benign Het
Zyg11a G A 4: 108,040,845 (GRCm39) P703S probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGACGTGGCTTCGATTG -3'
(R):5'- CACTAAGTTTGTTCAGGGCTGG -3'

Sequencing Primer
(F):5'- TGGCTTCGATTGGGCGG -3'
(R):5'- TCTAGCGTCCCCGGCTC -3'
Posted On 2019-11-26