Incidental Mutation 'R7789:Vmn2r99'
ID 599769
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19361949-19401098 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19393817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 600 (V600F)
Ref Sequence ENSEMBL: ENSMUSP00000135236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect possibly damaging
Transcript: ENSMUST00000176107
AA Change: V600F

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: V600F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Ptprm A T 17: 67,095,539 V118E probably damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
R8039:Vmn2r99 UTSW 17 19380040 missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19393758 missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19394181 missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19393660 critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19378126 nonsense probably null
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACAATCCCTGCAGTTAGAGATG -3'
(R):5'- GCAAATGTGGTCTGCTGAAG -3'

Sequencing Primer
(F):5'- TCATAGACTGAACTCCTAATCTCAAG -3'
(R):5'- CAAATGTGGTCTGCTGAAGGATGC -3'
Posted On 2019-11-26