Incidental Mutation 'R7789:Ptprm'
ID 599770
Institutional Source Beutler Lab
Gene Symbol Ptprm
Ensembl Gene ENSMUSG00000033278
Gene Name protein tyrosine phosphatase, receptor type, M
Synonyms RPTPmu
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7789 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 66666947-67354457 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67095539 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 118 (V118E)
Ref Sequence ENSEMBL: ENSMUSP00000045603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091]
AlphaFold P28828
Predicted Effect probably damaging
Transcript: ENSMUST00000037974
AA Change: V118E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: V118E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
MAM 22 184 2.81e-73 SMART
IG 191 279 2.1e-6 SMART
FN3 281 364 6.35e-4 SMART
FN3 380 468 2.81e-5 SMART
FN3 482 572 3.7e-5 SMART
transmembrane domain 743 764 N/A INTRINSIC
low complexity region 765 774 N/A INTRINSIC
PTPc 899 1156 5.26e-135 SMART
PTPc 1185 1450 9.46e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223982
AA Change: V118E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224091
AA Change: V118E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,311 E163K probably benign Het
Adam34 T A 8: 43,652,451 R52S probably benign Het
Adcy8 A T 15: 64,871,774 C328* probably null Het
Ankrd26 G T 6: 118,527,798 H717N probably damaging Het
Ankrd26 G T 6: 118,527,799 S716R possibly damaging Het
Ankrd40 C A 11: 94,334,709 P189T probably damaging Het
Anln A G 9: 22,352,037 S113P Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Asxl1 C T 2: 153,400,023 T832I probably benign Het
Bicd2 C T 13: 49,379,659 R574C probably damaging Het
Boll T C 1: 55,360,667 probably null Het
Casr A G 16: 36,495,291 F806L probably damaging Het
Casz1 C A 4: 148,929,406 N142K probably benign Het
Cbl C T 9: 44,163,467 D433N probably damaging Het
Ceacam14 T A 7: 17,814,171 V62D probably damaging Het
Chst10 T C 1: 38,884,451 N18S probably benign Het
Cyp2j6 C T 4: 96,545,716 R119H probably benign Het
Cyp4a14 C G 4: 115,494,910 V102L probably benign Het
Dnajb3 A T 1: 88,205,677 M1K probably null Het
Dnajc6 A T 4: 101,618,532 K534M possibly damaging Het
Dnase2a T C 8: 84,908,876 probably null Het
Dock10 A G 1: 80,559,213 I985T possibly damaging Het
Emsy G T 7: 98,621,489 P436Q probably damaging Het
Enpp1 A T 10: 24,654,083 probably null Het
Erc1 T A 6: 119,773,709 R353* probably null Het
Fam196b T A 11: 34,402,537 M193K probably benign Het
Fbn2 T A 18: 58,039,313 D2140V probably benign Het
Fgfr1 T A 8: 25,562,313 Y218* probably null Het
Fhod1 C T 8: 105,330,108 R1045H probably damaging Het
Focad G T 4: 88,229,406 L427F unknown Het
Gbf1 T A 19: 46,254,002 L144M probably damaging Het
Glmn T G 5: 107,549,075 N592T probably benign Het
Golgb1 C G 16: 36,875,399 P87A unknown Het
H2bfm G A X: 136,927,722 R120K unknown Het
Itga9 T G 9: 118,658,496 F216V possibly damaging Het
Klhl18 T C 9: 110,439,008 D149G unknown Het
Lcat C T 8: 105,942,225 V114M probably benign Het
Lrrc8c C A 5: 105,607,200 N280K probably damaging Het
Mettl8 T C 2: 70,966,462 Y283C probably damaging Het
Mgat4a A T 1: 37,490,279 I173K probably damaging Het
Mmp1a T C 9: 7,475,265 V345A possibly damaging Het
Mok T A 12: 110,811,827 H215L probably damaging Het
Mphosph9 C G 5: 124,315,587 E221Q probably damaging Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Myom1 A G 17: 71,117,436 T1525A probably benign Het
Nap1l1 C T 10: 111,490,456 S143L probably benign Het
Olfr366 C T 2: 37,219,660 T57I probably benign Het
Olfr531 A T 7: 140,400,697 Y116* probably null Het
Olfr646 T A 7: 104,106,988 S236R probably damaging Het
Olfr847 G T 9: 19,375,065 T272K probably benign Het
Plbd2 T C 5: 120,485,754 S568G probably damaging Het
Plxna4 T A 6: 32,206,233 probably null Het
Plxnc1 T A 10: 94,794,477 E1520V probably damaging Het
Ppil3 G A 1: 58,434,379 T104I possibly damaging Het
Rimbp2 T C 5: 128,774,335 D849G probably damaging Het
Rnf213 T C 11: 119,470,219 probably null Het
Sema3f T A 9: 107,705,432 K37N probably benign Het
Sh3glb1 G T 3: 144,692,131 probably null Het
Sh3rf3 A G 10: 59,086,815 D571G probably benign Het
Sipa1l3 T C 7: 29,377,725 Y874C probably damaging Het
Smchd1 G A 17: 71,475,301 probably benign Het
Snrnp70 A T 7: 45,376,621 Y441* probably null Het
Ssrp1 C T 2: 85,041,181 R316W probably damaging Het
Syt10 A T 15: 89,826,898 V144E probably damaging Het
Tdrd12 A G 7: 35,488,692 L562P Het
Trim68 T C 7: 102,684,469 D2G possibly damaging Het
Trub2 T A 2: 29,777,908 H240L probably damaging Het
Tssc4 A G 7: 143,069,778 probably null Het
Usp7 T A 16: 8,698,811 Q539L probably benign Het
Vmn2r17 T A 5: 109,452,965 C710S possibly damaging Het
Vmn2r99 G T 17: 19,393,817 V600F possibly damaging Het
Vps13d C T 4: 145,100,065 V2879M Het
Vrtn T A 12: 84,650,306 M610K probably benign Het
Xpo4 T C 14: 57,613,349 E366G probably benign Het
Zyg11a G A 4: 108,183,648 P703S probably damaging Het
Other mutations in Ptprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Ptprm APN 17 66817972 missense probably damaging 1.00
IGL01128:Ptprm APN 17 67042101 missense probably damaging 1.00
IGL01509:Ptprm APN 17 66762213 missense possibly damaging 0.95
IGL01785:Ptprm APN 17 66685623 missense probably damaging 1.00
IGL01912:Ptprm APN 17 67046118 missense probably benign 0.13
IGL01929:Ptprm APN 17 66690549 missense probably damaging 1.00
IGL01937:Ptprm APN 17 67046163 splice site probably benign
IGL01939:Ptprm APN 17 67063163 splice site probably benign
IGL02053:Ptprm APN 17 66693841 missense probably damaging 1.00
IGL02203:Ptprm APN 17 66953123 missense probably damaging 1.00
IGL02468:Ptprm APN 17 66814509 missense probably benign 0.02
IGL02500:Ptprm APN 17 66920048 missense probably damaging 0.99
IGL02542:Ptprm APN 17 66920150 missense probably benign
Becalming UTSW 17 66944332 splice site probably null
Pacifying UTSW 17 66683408 missense possibly damaging 0.74
R0674:Ptprm UTSW 17 67191341 missense possibly damaging 0.52
R0709:Ptprm UTSW 17 66944332 splice site probably null
R1054:Ptprm UTSW 17 67042318 missense probably damaging 1.00
R1522:Ptprm UTSW 17 66693871 missense possibly damaging 0.91
R1561:Ptprm UTSW 17 66940541 missense probably damaging 1.00
R1726:Ptprm UTSW 17 67042327 missense probably damaging 1.00
R1744:Ptprm UTSW 17 66689366 missense probably damaging 1.00
R1873:Ptprm UTSW 17 66688355 missense probably damaging 1.00
R1951:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1952:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1953:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1993:Ptprm UTSW 17 66747160 missense probably damaging 1.00
R2017:Ptprm UTSW 17 66957153 splice site probably null
R2266:Ptprm UTSW 17 66725851 splice site probably null
R2417:Ptprm UTSW 17 66944326 missense probably damaging 0.97
R2511:Ptprm UTSW 17 66693778 missense probably damaging 1.00
R3726:Ptprm UTSW 17 66956860 missense possibly damaging 0.91
R3824:Ptprm UTSW 17 66809575 missense probably benign 0.40
R4057:Ptprm UTSW 17 67075663 missense possibly damaging 0.93
R4113:Ptprm UTSW 17 66725813 missense probably damaging 1.00
R4559:Ptprm UTSW 17 66683408 missense possibly damaging 0.74
R4598:Ptprm UTSW 17 67095497 missense probably benign 0.00
R4742:Ptprm UTSW 17 66744751 nonsense probably null
R4974:Ptprm UTSW 17 66678067 missense probably benign 0.01
R5157:Ptprm UTSW 17 66957097 missense probably benign 0.09
R5433:Ptprm UTSW 17 66693473 missense probably damaging 1.00
R5509:Ptprm UTSW 17 66689358 missense probably damaging 1.00
R5586:Ptprm UTSW 17 66920196 missense probably damaging 1.00
R5820:Ptprm UTSW 17 66689465 missense probably damaging 1.00
R5867:Ptprm UTSW 17 67045981 splice site probably null
R6044:Ptprm UTSW 17 66693862 missense probably damaging 1.00
R6229:Ptprm UTSW 17 66688300 missense probably damaging 1.00
R6615:Ptprm UTSW 17 67353956 critical splice donor site probably null
R6969:Ptprm UTSW 17 66912418 missense possibly damaging 0.63
R7135:Ptprm UTSW 17 66944288 missense possibly damaging 0.93
R7161:Ptprm UTSW 17 66809627 missense probably benign 0.21
R7410:Ptprm UTSW 17 66693566 missense probably damaging 0.99
R7476:Ptprm UTSW 17 66725791 missense probably benign 0.01
R8027:Ptprm UTSW 17 66944205 missense probably damaging 1.00
R8089:Ptprm UTSW 17 66683488 missense possibly damaging 0.63
R8442:Ptprm UTSW 17 66944317 missense possibly damaging 0.70
R8476:Ptprm UTSW 17 66944322 missense probably damaging 1.00
R8866:Ptprm UTSW 17 66809635 missense probably benign 0.00
R8907:Ptprm UTSW 17 66744737 missense probably damaging 0.99
R8930:Ptprm UTSW 17 66956851 missense probably benign 0.03
R8932:Ptprm UTSW 17 66956851 missense probably benign 0.03
R9009:Ptprm UTSW 17 66689359 missense probably damaging 1.00
R9084:Ptprm UTSW 17 66956953 missense possibly damaging 0.93
R9338:Ptprm UTSW 17 66762148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCACACTTCAGAAGAGC -3'
(R):5'- AAAACTGTTTTGGGTTTTGACGCTC -3'

Sequencing Primer
(F):5'- CTTCAGAAGAGCATACCTACTGTGG -3'
(R):5'- GACGCTCTGCTTTTGTTCCCG -3'
Posted On 2019-11-26