Mutagenetix > Incidental Mutation

Incidental Mutation 'R7789:Myom1'

599771

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

045845-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7789 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71117436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1525 (T1525A)

Ref Sequence

ENSEMBL: ENSMUSP00000072945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

PDB Structure

Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000024847
AA Change: T1427A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: T1427A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073211
AA Change: T1525A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: T1525A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179759
AA Change: T1427A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: T1427A

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	G	A	16: 4,864,311	E163K	probably benign	Het
Adam34	T	A	8: 43,652,451	R52S	probably benign	Het
Adcy8	A	T	15: 64,871,774	C328*	probably null	Het
Ankrd26	G	T	6: 118,527,798	H717N	probably damaging	Het
Ankrd26	G	T	6: 118,527,799	S716R	possibly damaging	Het
Ankrd40	C	A	11: 94,334,709	P189T	probably damaging	Het
Anln	A	G	9: 22,352,037	S113P		Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Asxl1	C	T	2: 153,400,023	T832I	probably benign	Het
Bicd2	C	T	13: 49,379,659	R574C	probably damaging	Het
Boll	T	C	1: 55,360,667		probably null	Het
Casr	A	G	16: 36,495,291	F806L	probably damaging	Het
Casz1	C	A	4: 148,929,406	N142K	probably benign	Het
Cbl	C	T	9: 44,163,467	D433N	probably damaging	Het
Ceacam14	T	A	7: 17,814,171	V62D	probably damaging	Het
Chst10	T	C	1: 38,884,451	N18S	probably benign	Het
Cyp2j6	C	T	4: 96,545,716	R119H	probably benign	Het
Cyp4a14	C	G	4: 115,494,910	V102L	probably benign	Het
Dnajb3	A	T	1: 88,205,677	M1K	probably null	Het
Dnajc6	A	T	4: 101,618,532	K534M	possibly damaging	Het
Dnase2a	T	C	8: 84,908,876		probably null	Het
Dock10	A	G	1: 80,559,213	I985T	possibly damaging	Het
Emsy	G	T	7: 98,621,489	P436Q	probably damaging	Het
Enpp1	A	T	10: 24,654,083		probably null	Het
Erc1	T	A	6: 119,773,709	R353*	probably null	Het
Fam196b	T	A	11: 34,402,537	M193K	probably benign	Het
Fbn2	T	A	18: 58,039,313	D2140V	probably benign	Het
Fgfr1	T	A	8: 25,562,313	Y218*	probably null	Het
Fhod1	C	T	8: 105,330,108	R1045H	probably damaging	Het
Focad	G	T	4: 88,229,406	L427F	unknown	Het
Gbf1	T	A	19: 46,254,002	L144M	probably damaging	Het
Glmn	T	G	5: 107,549,075	N592T	probably benign	Het
Golgb1	C	G	16: 36,875,399	P87A	unknown	Het
H2bfm	G	A	X: 136,927,722	R120K	unknown	Het
Itga9	T	G	9: 118,658,496	F216V	possibly damaging	Het
Klhl18	T	C	9: 110,439,008	D149G	unknown	Het
Lcat	C	T	8: 105,942,225	V114M	probably benign	Het
Lrrc8c	C	A	5: 105,607,200	N280K	probably damaging	Het
Mettl8	T	C	2: 70,966,462	Y283C	probably damaging	Het
Mgat4a	A	T	1: 37,490,279	I173K	probably damaging	Het
Mmp1a	T	C	9: 7,475,265	V345A	possibly damaging	Het
Mok	T	A	12: 110,811,827	H215L	probably damaging	Het
Mphosph9	C	G	5: 124,315,587	E221Q	probably damaging	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Nap1l1	C	T	10: 111,490,456	S143L	probably benign	Het
Olfr366	C	T	2: 37,219,660	T57I	probably benign	Het
Olfr531	A	T	7: 140,400,697	Y116*	probably null	Het
Olfr646	T	A	7: 104,106,988	S236R	probably damaging	Het
Olfr847	G	T	9: 19,375,065	T272K	probably benign	Het
Plbd2	T	C	5: 120,485,754	S568G	probably damaging	Het
Plxna4	T	A	6: 32,206,233		probably null	Het
Plxnc1	T	A	10: 94,794,477	E1520V	probably damaging	Het
Ppil3	G	A	1: 58,434,379	T104I	possibly damaging	Het
Ptprm	A	T	17: 67,095,539	V118E	probably damaging	Het
Rimbp2	T	C	5: 128,774,335	D849G	probably damaging	Het
Rnf213	T	C	11: 119,470,219		probably null	Het
Sema3f	T	A	9: 107,705,432	K37N	probably benign	Het
Sh3glb1	G	T	3: 144,692,131		probably null	Het
Sh3rf3	A	G	10: 59,086,815	D571G	probably benign	Het
Sipa1l3	T	C	7: 29,377,725	Y874C	probably damaging	Het
Smchd1	G	A	17: 71,475,301		probably benign	Het
Snrnp70	A	T	7: 45,376,621	Y441*	probably null	Het
Ssrp1	C	T	2: 85,041,181	R316W	probably damaging	Het
Syt10	A	T	15: 89,826,898	V144E	probably damaging	Het
Tdrd12	A	G	7: 35,488,692	L562P		Het
Trim68	T	C	7: 102,684,469	D2G	possibly damaging	Het
Trub2	T	A	2: 29,777,908	H240L	probably damaging	Het
Tssc4	A	G	7: 143,069,778		probably null	Het
Usp7	T	A	16: 8,698,811	Q539L	probably benign	Het
Vmn2r17	T	A	5: 109,452,965	C710S	possibly damaging	Het
Vmn2r99	G	T	17: 19,393,817	V600F	possibly damaging	Het
Vps13d	C	T	4: 145,100,065	V2879M		Het
Vrtn	T	A	12: 84,650,306	M610K	probably benign	Het
Xpo4	T	C	14: 57,613,349	E366G	probably benign	Het
Zyg11a	G	A	4: 108,183,648	P703S	probably damaging	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2351:Myom1	UTSW	17	71034579	missense	probably damaging	0.98
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
R9612:Myom1	UTSW	17	71105480	nonsense	probably null
R9645:Myom1	UTSW	17	71092209	missense	probably benign	0.01
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ACTGATGACACTCTCTTCGC -3'
(R):5'- GACTGCCTTGCCAAGAAATC -3'

Sequencing Primer
(F):5'- TCTTCGCCCTAACAGTGGGAC -3'
(R):5'- GAGGCCATTATGTTAGCCTAGCC -3'

Posted On

2019-11-26