Incidental Mutation 'R7790:Dennd4c'
ID599793
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7790 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86799517 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 584 (T584A)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045512
AA Change: T584A

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: T584A

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082026
AA Change: T584A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: T584A

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142837
AA Change: T584A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: T584A

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
3110043O21Rik T C 4: 35,192,997 D444G unknown Het
4932415D10Rik C T 10: 82,287,495 C3227Y probably benign Het
Abca13 A T 11: 9,297,915 K2554M probably damaging Het
Ankrd12 C T 17: 65,984,230 D1403N possibly damaging Het
Ankrd17 A G 5: 90,260,152 V1402A possibly damaging Het
Ankrd36 A T 11: 5,635,176 N329I possibly damaging Het
Atr A T 9: 95,874,180 D815V probably damaging Het
Ceacam1 T C 7: 25,473,950 Y271C probably damaging Het
Cenpo T C 12: 4,214,597 H265R probably benign Het
Chd8 G A 14: 52,226,082 R702W probably damaging Het
Ckap5 A G 2: 91,559,110 N309S probably benign Het
Cxxc1 C T 18: 74,217,784 R83C probably damaging Het
Dcaf6 T C 1: 165,399,715 D281G probably damaging Het
Dync2h1 G T 9: 7,114,914 H2415N probably damaging Het
Dzip1l A G 9: 99,660,962 E490G possibly damaging Het
Fam124a T C 14: 62,606,077 S345P probably benign Het
Fam83b G A 9: 76,492,048 T591I probably benign Het
Frem1 T C 4: 82,989,164 S838G probably benign Het
Fsip2 G T 2: 82,988,379 D4819Y probably benign Het
Gm43302 T G 5: 105,277,825 K246T probably benign Het
Gm5861 C A 5: 11,184,218 H30Q probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gpc1 A T 1: 92,853,449 H90L probably benign Het
Grik3 T C 4: 125,686,019 L519P probably damaging Het
Grwd1 A G 7: 45,826,014 V368A probably damaging Het
Gstm3 G A 3: 107,969,239 probably benign Het
Gtpbp6 A G 5: 110,104,386 S427P probably damaging Het
Heatr5b C T 17: 78,818,823 G560E probably damaging Het
Heatr9 A G 11: 83,518,193 V176A probably damaging Het
Hsf2bp A G 17: 32,034,479 V5A probably benign Het
Ints3 G T 3: 90,400,413 Q660K probably benign Het
Itpr2 A T 6: 146,224,776 L2048Q probably damaging Het
Kcnq1 G A 7: 143,106,605 probably null Het
Lsm12 A T 11: 102,165,169 probably null Het
Mcoln3 A G 3: 146,139,492 Y481C probably damaging Het
Meis3 A G 7: 16,182,397 N266D probably benign Het
Mgat5 G A 1: 127,412,204 E441K probably benign Het
Mroh6 C T 15: 75,884,240 R689H probably benign Het
Mtg1 T C 7: 140,149,749 Y251H probably damaging Het
Mtus2 A T 5: 148,078,188 Q597L probably benign Het
Myt1 A G 2: 181,797,597 E346G probably benign Het
Nat8f4 A G 6: 85,900,891 S217P probably benign Het
Ngf G A 3: 102,509,824 G17R unknown Het
Olfr863-ps1 A T 9: 19,941,684 M252K unknown Het
Pam T C 1: 97,821,847 Y968C probably damaging Het
Pcdhga7 T A 18: 37,714,943 M1K probably null Het
Pde8b G T 13: 95,034,171 D554E probably benign Het
Pdzd7 G A 19: 45,045,523 R41* probably null Het
Pkhd1l1 C T 15: 44,578,581 P3639S probably damaging Het
Plce1 A T 19: 38,780,696 E2280V probably damaging Het
Prrxl1 T A 14: 32,628,888 L227Q probably damaging Het
Ryr1 T C 7: 29,104,832 I538V probably benign Het
Scaf11 A G 15: 96,419,061 L874P possibly damaging Het
Scpep1 G T 11: 88,933,521 D307E possibly damaging Het
Sept4 A G 11: 87,589,239 E327G probably damaging Het
Skint2 T G 4: 112,616,554 V11G possibly damaging Het
Slc26a4 T C 12: 31,544,483 N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slx4 T C 16: 3,986,982 E656G probably benign Het
Socs5 T C 17: 87,134,363 S244P probably benign Het
Stt3b A C 9: 115,276,819 L196R probably damaging Het
Syne2 T A 12: 75,929,103 probably null Het
Tab2 T A 10: 7,920,424 N24I probably damaging Het
Taf4b T C 18: 14,813,274 S385P probably damaging Het
Tg T C 15: 66,849,604 Y2720H probably damaging Het
Tjap1 C T 17: 46,258,690 G448E probably benign Het
Tll1 A T 8: 64,025,237 C827* probably null Het
Tlr11 T A 14: 50,361,925 I456K probably benign Het
Tmem209 T C 6: 30,497,855 D305G probably damaging Het
Tmem82 A T 4: 141,617,724 probably null Het
Tnfrsf14 A G 4: 154,923,293 V207A probably benign Het
Tnks A T 8: 34,861,540 N625K probably benign Het
Tomm20 G A 8: 126,939,950 P58S possibly damaging Het
Ttc9b A G 7: 27,654,336 D137G probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Usp9y T A Y: 1,444,573 D122V probably damaging Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Wdr49 T A 3: 75,275,028 N698I probably benign Het
Zfp568 G A 7: 30,022,725 C365Y probably damaging Het
Zfp663 A T 2: 165,352,533 C589S probably damaging Het
Zfp971 A G 2: 178,033,499 K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 E173* probably null Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
R8307:Dennd4c UTSW 4 86825872 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCTTGTCAGTTCACCGAAAAC -3'
(R):5'- GTACACAACACATTGGACTCTTC -3'

Sequencing Primer
(F):5'- CCTCAAGAAAGTTCAGCAATTGAG -3'
(R):5'- GTAGGTTACAGGAAATGCAAATTCC -3'
Posted On2019-11-26